What are the differences between miRNA and siRNA? (Select all that apply.) OmiRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are from 22 to 30 bases long, and siRNAs are 22 bases long. O miRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs help with the processing of the initial mRNA transcribed from DNA into a mature form. miRNAs prevent translation of certain mRNAs, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are 20 to 22 bases long, and siRNAs are from 20 to 30 bases long.

What are the differences between miRNA and siRNA? (Select all that apply.) OmiRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are from 22 to 30 bases long, and siRNAs are 22 bases long. O miRNAs carry the genetic information from the DNA in the nucleus directly to the cytoplasm, and siRNAs help with the processing of the initial mRNA transcribed from DNA into a mature form. miRNAs prevent translation of certain mRNAs, and siRNAs are involved in the degradation of specific mRNA molecules. miRNAs are 20 to 22 bases long, and siRNAs are from 20 to 30 bases long.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 18QP: The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this...

See similar textbooks

Similar questions

Which statement is false: A) Each type of protein ( ex: hemoglobin vs trypsionngen) varies in the length and amino acid sequence of its peptide B) After the rpocess of transcription is complete, the mRNA that is produced will continue being tranlsated by ribosomes for the rest of the cells life. mRNA never breaks down C) A ribosome will bind to an mRNA and will translate the sequence by reading one codon at a time and adding one amino acid to the peptide chain. It will stop the translation once it encounters a stop codon D) The gene for a protein provides the information on the legth of the peptide, along w the amino acid sequence so the protein can be synthesized by a ribosome E) Once mRNA has left the nucleus, ribosomes will bind to it and will follow the instructions in its sequence to make the new protien
Consider the following sequence fragment of an mRNA. Which of the miRNAS below would be competent for gene silencing? 5'-AUGCAAGCAUUGGCCAAGCUU-3' 5'-AUGCAAGCAUUGGCCAAGCUU-3 5'-UACGUUCGUAACCGGUUCGAA-3' 5'-AAGCUUGGUUAAUGCUUGCAU-3' 5'-UUCGAACCAAUUACGAACGUA-3' 3'-UUCGAACCAAUUACGAACGUA-5 3'-AUGCAAGCAUUGGCCAAGCUU-5'
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.
he sequence is read from left to right. The table below shows which mRNA codons code for each type of amino acid. UUA - Leu | UCA - Ser UAA - Stop | UGA-Stop UUU - Phe | UCU - Ser UAU- Tyr UGU- Cys CỦA - Leu CCA - Pro CAA - Gln | CGA - ArgA UUG - Leu UCG - Ser| UAG-Stop UGG- TrpG A DNA sequence before and after replication IS SHO Second mRNA base G DNA sequence before replication: UUC - Phe UCC -Ser UAC U TACCTAGCT Туг UGC Cys DNA sequence after replication: A TACCTCGCT Leu CCU - Pro CAU - His CGU. CUU Arg U - Pro CAC - His CGC- ArgC CUC - Leu ССС Pro CAG - Gln | CGG - Arg G CUG - Leu CCG Thr AAU - Asn AGU - Ser Ile ACC - Thr AAC- Asn AGC Ile ACU AUU AUC Ser Lys AGA Arg Thr AAG - Lys AGG - AUA Ile ACA - Thr AAA- A mutation occurred in the DNA sequence during replication. Which of the following, A-D, Arg Asp GGU-Gly AUG - Met ACG GUU - Val GCU - Ala GAU - GỤC - Val GCC - Ala GAC - Asp GGC - Gly Val GCA -Ala GAA - Glu GGA - Gly Val GCG - Ala GAG-Glu GGG-Glv describes the result of the…
One of your patients, a six-year-old girl who suffers from Sickle cell anemia, an inherited blood disorder in which red blood cells are abnormally shaped and fragile, leading to a short supply of red blood cells. These abnormal cells can also get stuck in small vessels, which prevent blood flow, leading to fatigue, pain and other severe complications. What is the name of the process in which each peptide is actually assembled, and where does this process take place? transcription, on ribosomes translation, in the nucleus translation, on ribosomes transcription, in the nucleus
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…
Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'
a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Termination
. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?
Match the regulatory RNA to each of the following descriptions. Regulatory RNA that prevents transcription by recruiting DNMT enzymes Regulatory RNA that prevents translation by acting either in cis- or trans- but not by binding RISC Regulatory RNA found only in eukaryotes that is not perfectly complementary to the target RNA [Choose ] [Choose ] [Choose ] antisense RNA siRNA IncRNA miRNA riboswitch <
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'