Using the following expression vector and the insert of interest with flaking region (PCR product of gene Psy2 and flanking region), which of these possibilities will result in the expression of the cloned gene with the highest efficiency? Stul: 5'-AGG|CCT-3 3'-TCC GGA-5 SalI cuts: 5 -G|TCGAC-3' 3'-CAGCT|G-5' ECORI: 5'-G|AATTC-3' 3'-CTTAA|G-5' Promoter P StyL_ Sall EcoRI Eco RI Stul Start codon Sll Vector 2 TCCGGCGGAATTCCAAGGCCT SAGGTTCCGGE psy2 CGTCGACTCCGGC 3' GCAGCTGAGGCCG 5'

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: elomere position effect (TPE) alters the gene expression in yeast cells? why?

A: Transcription and replication of adjacent DNA is affected by telomere.telomeres also impose an edge…

Q: You are working with a laboratory strain of E.coli that contains a 10 base-pair deletion in the Lac…

A: Introduction of the concept: The given concept is based on the lac operon in E.coli. The operon…

Q: Identify the roles of the PCR2 complex in the repression of transcription by HOTAIR.

A: * HOTAIR stands for HOX transcript antisense RNA  is a gene  which can be found between HOXC11 and…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: What detection method could be used to determine a different restriction enzyme that is used in…

A: Vectors are DNA molecules that act as transporting vehicle which carries foreign DNA into a host…

Q: What would be the consequence of inserting 10 random base pairs immediately downstream of the -10…

A: The insertion of 10 random base pairs immediately downstream of the -10 box in a strong promoter may…

Q: What is a technique for which  Drosophila melanogaster  that results in a white eye mutation can be…

A: A cDNA library is a collection of cloned cDNA (complementary DNA) fragments, which is used to…

Q: Compare and contrast the use of histochemical reporter genes and fluorescent reporter genes — what…

A: Reporter genes can be analyzed by different methods, such as beta glucuronidase (uidA) gene…

Q: Describe the primary procedure(key steps no details) that you will follow to clone the C-peptide…

A: C-peptide or connecting peptide refers to the polypeptide spanning 31 amino acids that connects…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure , which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material of the most of the organisms that carry coded…

Q: Compatible ends generated by restriction enzyme can be connected by ligase. Determine which of the…

A: Restriction enzymes are proteins that cut DNA at specific sequences. These sequences are usually…

Q: Gerald Rubin and Allan Spradling devised a method of introducinga transposon into Drosophila. This…

A: Plasmids are the genetic structures, which can replicate independent of chromosomes. They are the…

Q: Which restriction enzyme is best suited for cloning in pUC8?

A: The restriction enzymes are specific endonuclease that cut the double stranded DNA from the middle…

Q: How DNA recombination is used in unique variable region coding?

A: A process by which Cells randomly assemble immunoglobulin gene segments .v, d, and j gene segment to…

Q: How will this modified cro protein interact with the three OR sites, and how would cro expression be…

A: Bacteriophages are viruses that infect bacteria. Like other viruses bacteriophages are also made up…

Q: According to the scenario shown, how many segments of DNA (one, two, or three) are removed during…

A: Genetics is the branch of biology which deals with genes, heredity, and genome in the organism.…

Q: How would you use a ChIP (chromatin immunoprecipitation) to show that when RNA pol II is bound at…

A: Chromatin immunoprecipitation is a technique used for the investigation of DNA (deoxyribonucleic…

Q: What would a scientist need to use CRISPR-Cas system to introduce a specific point mutation into a…

A: When the target DNA is located, Cas9, one of the CRISPR system's enzymes, latches to it and chops…

Q: How can the efficiency of homologous recombination be improved when using CRISPR-Cas9, compared to…

A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a technique derived from…

Q: An EMS mutagenesis screen identified several mutants in this gene. The figure shows the position of…

A: "As per the Q&A guidelines, we will provide the solution to the first question. Please repost…

Q: Your insert has the sequence TGGATCCTTATAATGTTT.....Which pET-41 vector will you use to clone with…

A: To determine which vector is best for you, you will need to consider the reading frame of your…

Q: The main difference between Type I and Type ll mobile genetic elements is that Type I spread via a :…

A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: Primer 1 primes synthesis of the 5' to 3' strand (i.e. sense strand) of an oat cDNA/gene and encodes…

A: A primer is sometimes known to state because the short sequence of nucleic acids that's the…

Q: You receive purified mRNA encoding the peak protein of SARS Cov-2 as well as the plasmid pET32 (a…

A: DNA cloning with plasmid vector involves the addition of a foreign gene into a plasmid vector. The…

Q: Knock out mice that are mutant for a gene product X die. Variants of the X gene that were…

A: The physical crossing over during meiosis of parental heterozygous homologous chromosomes or genes…

Q: A certain cDNA of size 2 kb hybridized to eight genomicfragments of total size 30 kb and contained…

A: Introduction :- In the presence of reverse transcriptase, cDNA is a complementary DNA to a given RNA…

Q: Pls help ASAP

A: X-Gal stands for 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside, and it is indeed a compound…

Q: A tumour inducing plasmid shown in Figure 2 is isolated from a soil bacterium. (i) Auxin Left Border…

A: A plasmid vector must have a single replication origin, a cloning site (where restriction enzymes…

Q: 1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein…

A: Vectors are DNA molecules that act as transporting vehicle which carries foreign DNA into a host…

Q: Based on the sensitivity of DNA to DNase I, as illustrated in Figure, which type of chicken…

A: Deoxyribonucleic acid (DNA) is the genetic material in most of the organisms that carry coded…

Q: Draw and explain how the recombinant DNA molecule can be produced in a pUC19 vector using a linear…

A: The process of genetically modifying a genome by adding a foreign or desired gene is known as…

Q: Section 1: Matching restriction enzyme Barr body CCAAT box enhancer TATA-binding protein A. highly…

A: Restriction enzymes: Restriction enzymes are important tools in molecular biology that are used to…

Q: 1) Using the diagram below, sketch in the pattern of bands you would expect to see after digesting…

A: TAS2R38 is a taste receptor gene present in the 7th chromosome of the genome. The length of a gene…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.