Using the following expression vector and the insert of interest with flaking region (PCR product of gene Psy2 and flanking region), which of these possibilities will result in the expression of the cloned gene with the highest efficiency? Stul: 5'-AGG|CCT-3 3'-TCC GGA-5 SalI cuts: 5 -G|TCGAC-3' 3'-CAGCT|G-5' ECORI: 5'-G|AATTC-3' 3'-CTTAA|G-5' Promoter P StyL_ Sall EcoRI Eco RI Stul Start codon Sll Vector 2 TCCGGCGGAATTCCAAGGCCT SAGGTTCCGGE psy2 CGTCGACTCCGGC 3' GCAGCTGAGGCCG 5'

Q: Mediator is not necessary to reproduce transcription initiation reactions in vitro. If you are…

A: In the study of eukaryotic gene expression, understanding the process of transcription initiation is…

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: If the 5’ splice site sequences changed from 5’GUAAGU 3’ to 5’ GUAUGU 3’, predict the effect of the…

A: RNA produced during transcriptional process containing introns are known as heterogeneous nuclear…

Q: FACTORS AFFECTING BACTERIAL EXPRESSION SYSTEM

A:

Q: Mutant #    Deletion Region    %Transcription (lungs)  %Transcription(kidneys) WT…

A: The genes that are expressed in a variety of organs in the body are the general-purpose genes. Such…

Q: You complete a comparative transcriptomics experiment, where RNA from a plant sample grown in sandy…

A: The researchers compared the gene expression differences between plants cultivated in silty soil and…

Q: What is the difference between a gene knockout and a gene knockin?

A: The knock-in and knock-out are the genetic engineering methods in which genes are altered in mice…

Q: In Figure 17-26, the bottom panel shows that genes B andC are oriented in a different direction…

A: Inversion has many effects on genes either it has no effect or disrupts the gene function. This…

Q: searcher has made a UAS transgenic line that drives a muscle transcription factor is attached to GFP…

A: Recessive character is only expressed in homozygous condition where as dominant character is…

Q: Which of the following types of media should be used to test the heterozygous diploid versions of…

A: Heterozygous diploid refers to a cell or organism that has two different alleles for a particular…

Q: Site specific recombination using Cre-Lox system shown below will result in InxP JoxP Transformation…

A: Question - 1 - Site specific recombination using Cre-Lox system shown below will result in…

Q: using illustrations describe the structure of a typical cloning vector and discuss the functions of…

A: Vector is a DNA molecule that is used as a carrier or vehicle for carrying foreign genetic material…

Q: Please make this as SIMPLE as possible Question: regarding to horizontal gene transfer

A: Horizontal gene transfer mainly occurs in prokaryotes.

Q: What would be the consequence of inserting 10 random base pairs immediately downstream of the -10…

A: The insertion of 10 random base pairs immediately downstream of the -10 box in a strong promoter may…

Q: A cystic-fibrosis mutation in a certain pedigree is due toa single nucleotide-pair change. This…

A: To explain: To explain about careers of cystic fibrosis and the risks of having cystic fibrosis…

Q: A researcher performed transcriptional profiling on control and treatment groups. The lab found that…

A: FDR is a statistical method to used to test multiple hypothesis to correct for multiple comparisons…

Q: Researchers create a recombinant DNA molecule in which the coding sequence for GFP is inserted…

A: Recombinant DNA is the DNA that is formed by insertion of gene of interest into the original DNA.…

Q: here is a hypothetical gene related to the nervous system of Drosophila. Describe all the methods,…

A: In situ hybridization (ISH) is a type of hybridization that uses a labeled complementary DNA, RNA or…

Q: position of the Start and Stop. The GFP and RFP genes shown do not have start

A: The Cre-Lox system is a widely used tool in genetic engineering for site-specific modifications in…

Q: control medium that demonstrates the general growth rate of mutant candidates

A: Control Medium: This medium is used to demonstrate the general growth rate of mutant candidates in…

Q: Compare and contrast the use of histochemical reporter genes and fluorescent reporter genes — what…

A: Reporter genes can be analyzed by different methods, such as beta glucuronidase (uidA) gene…

Q: occurring

A: The Department of agriculture regulates field testing of GM crops for research. The environmental…

Q: The 1000 aa protein (Protein X) you are studying has several putative caspase cleavage sites. You…

A: Western blotting is a molecular biology technique that is used to detect a specific protein from a…

Q: In organism that is mutant for components of the non-homologous end-joining NHEJ repair pathway…

A: CRISPR gene editing is a molecular biology genetic engineering tool for altering the genomes of…

Q: i have a gene (3222bp) i want to put it into a expression vector (pet 28b+),when i did pcr i flanked…

A: Introduction  Gene cloning is the technique to produce the exact copies of the desired gene by…

Q: Which restriction enzyme is best suited for cloning in pUC8?

A: The restriction enzymes are specific endonuclease that cut the double stranded DNA from the middle…

Q: leaves fall off when growers place plastic sleeves to cover the plant because of poor circulation…

A: Due to improper air circulation, potted plants' leaves curl and fall off when stored in plastic wrap…

Q: How would you use a ChIP (chromatin immunoprecipitation) to show that when RNA pol II is bound at…

A: Chromatin immunoprecipitation is a technique used for the investigation of DNA (deoxyribonucleic…

Q: How can the efficiency of homologous recombination be improved when using CRISPR-Cas9, compared to…

A: CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a technique derived from…

Q: You have isolated a mutant that you call Mutant Z. In a Mutant Z strain, the RNA polymerase can bind…

A: Here, the correct answer is option c) domain 2 of sigma and d) 3/4 linker of sigma.

Q: Site specific recombination using Cre-Lox system shown below will result in JoxP foxP faaP Fed JoP

A: Cre-Lox system is a site specific recombination technology, which is used for the deletion,…

Q: 5' ATGATCTCGTAA 3' 3' TACTAGAGCATT 5'

A: DNA, or deoxyribonucleic acid, is a hereditary molecule that encodes the blueprint for the growth,…

Q: When disrupting a mouse gene by knockout, why is it desirable to breed mice until offspring…

A: In knockout animal, a targeting vector having a gene of interest is introduced into the cells. The…

Q: 22. Scientists now routinely use CRISPR/Cas9 to make defined deletions of a gene that can remove…

A: Hi! Since you posted many questions, we will be answering only the first one for you (question 22).…

Q: the forward primer used in this experiment incorporates part of the cell recognition site, GGCC. How…

A: The TAS2R38 gene in individuals encodes a protein known as taste receptor 2 member 38. TAS2R38 is a…

Q: What does the Depletion of essential gene products causes chromosome loss and rearrangement major…

A: For normal growth and survival of a cell requires the accurate transmission of the genome. The cell…

Q: Primer 1 primes synthesis of the 5' to 3' strand (i.e. sense strand) of an oat cDNA/gene and encodes…

A: A primer is sometimes known to state because the short sequence of nucleic acids that's the…

Q: You receive purified mRNA encoding the peak protein of SARS Cov-2 as well as the plasmid pET32 (a…

A: DNA cloning with plasmid vector involves the addition of a foreign gene into a plasmid vector. The…

Q: Knock out mice that are mutant for a gene product X die. Variants of the X gene that were…

A: The physical crossing over during meiosis of parental heterozygous homologous chromosomes or genes…

Q: A certain cDNA of size 2 kb hybridized to eight genomicfragments of total size 30 kb and contained…

A: Introduction :- In the presence of reverse transcriptase, cDNA is a complementary DNA to a given RNA…

Genomic studies

Genomic studies (genomics) is the study of the whole genome of an organism. Using bioinformatics and high-performance computing, genomic researchers examined massive amounts of deoxyribonucleic acid (DNA)-sequence data to discover variations or mutations that affect drug response, health, or disease. Genomics is a much younger discipline than genetics, having only emerged in the last few decades as a result of technological advancements in DNA sequencing and computational biology.