Translation uses energy from all but O ATP hydrolysis O GTP hydrolysis O acetylation O cleavage of the high-energy bond between the amino acid and its cognate tRNA

Q: Which of the following events would NOT result in ribosomes stalling on an MRNA during translation?…

A: A release factor is a protein that recognizes a stop codon in an mRNA sequence and causes…

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…

A: Translation is the mechanism which enables ribosomes in the cytoplasm or endoplasmic reticulum to…

Q: Which of these statements is true about the elongation step of translation? O The growing…

A: Translation is the process by which the triplet base sequence of an mRNA guides the linking of a…

Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to…

A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various coding…

Q: Which of the following statements is/are true of stop codons in translation? O Stop codons signal…

A: When the polypeptides are being formed i.e. the process of translation from the mRNA with the help…

Q: Based on image of protein (enzyme), need to know: a) Number of amino acids and length (Angstroms)…

A: We are given the tertiary structure of a protein (enzyme). Here; the grey spheres indicate carbon…

Q: What group is added to modify methionine on the initiator tRNA in bacteria O phenyl O formyl O…

A: Initiator tRNAs (tRNAi) transport methionine (or its product, formyl-methionine) to ribosomes, where…

Q: The ribosomes ratchet back and forth with every pt'ase reaction in order to move the tRNAS and the…

A: During translation,  tRNAs carry amino acids to the ribosome and join with their complementary…

Q: Charging TRNAS entail: All of these choices are correct. O Proper recognition between the anticodon…

A: t RNA charging occurs in translation process where protein synthesis occured from mRNA.

Q: Please answer problem #3

A: Ligand is a substance that forms a complex with a biomolecule to serve a biological function. In…

Q: The antibiotic erythromycin disrupts protein synthesis by binding to the 50 S subunit and preventing…

A: tRNA is the transfer RNA . It is the smallest of three major species of RNA molecule. They transfer…

Q: Termination of translation occurs when: a charged tRNA gets stuck in the E site release factor…

A: Question - Termination of translation occurs when: a charged tRNA gets stuck in the E site…

Q: During elongation, TRNA binds initially to the A "P" site on the ribosome. B any available site on…

A: tRNA also called the transfer RNA and is an adaptor molecule. tRNA molecule at as a link between…

Q: TRNA O is a type of RNA molecule. required for accurate translation. O all of the choices are…

A: Translation is the process by which the RNA molecule is read and translated into proteins. The three…

Q: During the process of translation (protein synthesis), the mRNA strand is read From the middle…

A: Each and every protein that is made in our body or in any living organism is made by cell machinery…

Q: During translation, amino acid chain termination requires

A: Translation is the biological process of converting the mRNA sequence to a sequence of amino acids.…

Q: Think about a ribosome that has already created the dipeptide Met-Ala and is in the process of…

A: Translation is the process of converting the mRNA to proteins Proteins are made of amino acids. The…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: Choose the correct function of tRNA. O A, TRNAS are an intermediate stage of RNA processing where…

A: INTRODUCTION tRNA tRNA is transfer RNA molecule that can decode the mRNA and helps in the production…

Q: The genetic code derives its specificity through what interactions? O hydrogen bonds that maintain…

A: Genetic code: - Triplet - 64 different codons - 61 sense codons and 3 stop codons - Nearly universal…

Q: Glucose is the energy-ri molecule required for th initiation of translation O a. True h Ealse

A: Translation is that the method of translating the sequence of a RNA (mRNA) molecule to a sequence of…

Q: Which of the following is unique to eukaryotic mRNA synthesis? O Coupled transcription-translation O…

A: The correct option is Removal of Introns. Explanation:  Before it can be translated, eukaryotic…

Q: The initial step in the protein translation is described by: O release of the initiation factors…

A: There are 4 Biomacromolecules. They are ; Proteins Nucleic acids Carbohydrates and  Lipids

Q: A tRNA that has the anticodon GAG carries which amino acid?

A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…

Q: Protein undergoes modifications in ER before reaching their final destination. True O False pH of…

A: Proteins are synthesized by ribosomes which translate mRNa  in polypeptide chains . These proteins…

Q: In bacteria, but not in archaeans, the amino group of the methionine of the initiator tRNA is…

A: Introduction: Amino acids are biomolecules comprised of two functional groups; amino (NH2) and…

Q: A charged tRNA is approaching the ribosome during the translation of an mRNA. The anti-codon…

A: Translation, as related to genomics, is the process through which information encoded in messenger…

Q: Post-translational modifications of proteins may include which of the following processes? Hint:…

A: Please follow steps 2 & 3 for a detailed explanation of both questions.

Q: All tRNA molecules have poly (A) tails at their 3' end. Yes or no

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Ribosome Amino Acid Ribosome large subunit TRNA UCUAGAG MRNA Ribosome small subunit Figure:…

A: After the process of transcription, mRNA is formed which is translated into protein molecules by the…

Q: The site of post-translational cleavage of biologically active proteins is often ma O methylated…

A: Protein post-translational modifications (PTMs) increase the functional diversity of the proteome by…

Q: Transcription is the transfer of genetic - * .information from DNA to RNA O MRNA to TRNA O DNA to…

A: The genetic information is stored in the form of a nucleotide sequence in the DNA (deoxyribonucleic…

Q: The "charging" of tRNA requires which of the following? Select all that apply. Select one or more: O…

A: Introduction Amino acid activation which is also known as aminoacylation or tRNA charging refers to…

Q: Match the given step with the major central dogma event being referred to. An enzyme covalently adds…

A: Addition of 7-methyl guanosine triphosphate to the 5' end of pre-mRNA is a post transcriptional…

Q: Transcription and translation are separate processes in gene expression; however, they have…

A: Central dogma is a process where particular segment of DNA or gene ultimate express as a protein or…

Q: After translation (post-translation), eukaryotic proteins can be modified by: O a acetylation. Ob.…

A: Post-translation means translation products are modified by the addition of chemical groups to the…

Q: T A C C A G A T A C A C T C C C C T G C G A C T into an mRNa sequence and a…

A: The central dogma explains the flow of genetic information from DNA to RNA and then to protein. It…

Q: BONUS: In Bacteria, catalyzes formation of peptide bonds during translation (answers must be in…

A: RNA nucleotides are linked together by 3’-5’ phosphodiester linkages. The three min RNA in all the…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: DNA is the genetic material in most organisms. It is the information hub of the cell that contains…

Q: Transcription/Translation Practice WS АС DNA MRNA U АС TRNA AUU Tyr Amino Acid DNA TTT U UAG MRNA…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: The anticodon of tRNA interacts with the ATP for reaction energetics. amino acid. backbone…

A: Transfer ribonucleic acid is a type of RNA molecule that helps decode a messenger RNA sequence into…

Q: As the polypeptide is elongating during translation, what is the ribosome doing? O breaking hydrogen…

A: Translation is the process of protein synthesis. It occurs in the cytoplasm of cell.

Q: TRNA serves as template for the synthesis of polypeptide. True O False

A: Protein biosynthesis is a major biological process that occurs inside cells and balances the loss of…

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: The translation is one of the two processes by which gene expression takes place. Gene expression…

Q: Translocation during translation requires energy from the hydrolysis of Select one: O a. GTP O b.…

A: Translation is the process of formation of proteins from amino acids that are synthesized by the…

Q: The sequence of nucleotide on 5' - 3' of one strand of DNA is GTG TTT ATG TAA by transcription and…

A: DNA sequence  GTG  TTT  ATG  TAA on transcription RNA sequence  CAC  AAA  UAC  AUU

Health Assessment