The sequence of nucleotide on 5' - 3' of one strand of DNA is GTG TTT ATG TAA by transcription and translation it produce a poly peptide chain what is the sequence of amino acid in this polypeptide chain :-
Q: DIR TION: Express the following DNA nucleotide bases into amino acids A. 1. 3' ATA TTT CCG TAC CGC…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this,…
A: Answer: Central Dogma : It is the complete process of replication of DNA, transcription of DNA to…
Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…
A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…
Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…
A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…
Q: C4GUCAGUCAGUCO/ Use the codon chart to determine the following RNA strand in amino acids (Remember…
A: Genetic code The relationship between the sequence of amino acids in a polypeptide chain and…
Q: Since there are 61 sense codons (excluding stop codons), most cells contain 61 different types of…
A: A codon that codes for an amino acid is called the sense codon and there is three nonsense stop…
Q: The following sequence represents triplets on DNA: TAC CAG ATA CAC TCC CCT GCG ACT Give the mRNA…
A: Answer: CENTRAL DOGMA : It is the complete process of replication of DNA , transcription of DNA and…
Q: The codon sequence corresponds most closely to the sequence of the strand. MRNA O coding DNA TRNA O…
A: Most cells contain deoxyribonucleic acid (DNA) as their genetic material. Some also have ribonucleic…
Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: for an in vitro translation reaction. Which one would you leave out? Cell sap containing ribosomes O…
A: In vitro translation is a technique that in which a given mRNA is translated (outide the cell using…
Q: In RNA, an atypical base pair is able to form between guanine and uracil. This base pair allows a…
A: Introduction A Base Pair Is Made Up Of Two Chemical Bases That Are Bound Together To Form A "rung Of…
Q: Given DNA strand: 5' T G T T A G T C G A A T 3' Write its complementary DNA and its mRNA.
A: The DNA or deoxyribonucleic acid is the double standard helical macromolecule. It is the genetic…
Q: This CGT ACT GCA TCA GGC sequence of nucleotides is a referred to as sequence
A: Every biomolecules is a polymer made from a number of monomers. DNAs are the polymers of…
Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…
A: When DNA is converted into RNA then this is called transcription. When mRNA encodes protein then…
Q: Amino Acid Start Glycine Leucine Valine Glutamic Acid Proline C AA AAC CA A MRNA AUG C vA VA V DNA…
A: Translation is the process of synthesis of proteins from mRNA (serves as a template strand ) . Codon…
Q: Send A PEETRAS O
A: Transcription is the process of formation of RNA from the DNA.The transcription process takes place…
Q: How many amino acids does the mRNA strand above code for?
A: 1. 4 amino acids does the above mRNA strand code have -
Q: THCA 100 This reaction is Entropy is THC ( Leafly Mur AD RNA polymerase ATGACGOATCAGCCOCAAG…
A: Tetrahydrocannabinol Acid when heated converts into delta-9-tetrahydrocannabinol. the reaction is…
Q: 2 1] Amino acids are joined fogether into a protein chain by wfrnich of the following a transfer RNA…
A: Introduction :- Amino acids are the building blocks of proteins. The building blocks of life are…
Q: What is the net charge of the peptide at pH 7 that is synthesized from this DNA sequence? 5'…
A: As we know that the DNA sequence exhibits codons, which helps in the formation of mRNA, and then…
Q: How many unique polypeptides would you expect to see synthesized by an in vitro translation reaction…
A: The correct answer is Option B - 1 According to the question, the mRNA code is poly (AC)n This…
Q: Which of the following statements about protein elongation are correct? I. There is a nucleophilic…
A: Replication, transcription and translation are basic mechanisms performed by genetic material along…
Q: A particular triplet of bases in the template strand of DNA is 5' AGT 3: The corresponding codon for…
A: Transcription is a heterocatalytic action of DNA by means of which RNA is synthesized from specific…
Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…
A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…
Q: The genetic code is redundant (i.e., most amino acids are coded for by more than one codon). Why is…
A: Redundancy refers to differences in the third base of the codons coding for the same amino acid.
Q: 63 62 GI G5 G4 GGU AUG GCC AUG CUC TT T GAG CGG ACC CUC UUC UAC R (the strand) GAG AAG The circled…
A: Gene expression refers to producing protein from the template strand of DNA via mRNA as an…
Q: Some chemicals are known to cause mutations in DNA. EMS is a chemical that usually induces deletion…
A: Ethyl methanesulfonate is a mutagenic, teratogenic, and carcinogenic organic compound with formula…
Q: 3. 3' CTT TCT TGT AGT TẠC CGG GTA GAA TAG TTG CTG ACT 5'
A: DNA is the genetic material of most living organisms. The DNA is inherited from the parents and it…
Q: Amino Acids coded Order of Bases in DNA Order of Bases in Order of Bases in MRNA (codon) TRNA…
A: According to central dogma of molecular biology :- I ) DNA consists of two strand : coding and…
Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…
A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…
Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…
A: During transcription process, the strand used as template is known as template strand which sets in…
Q: Which of the following characteristics of B-sheet is incorrect? O In anti-parallel fashion, strands…
A: Proteins are the polymers of twenty standard amino acids attached together via peptide bonds. The…
Q: A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this,…
A: DNA refers to deoxyribonucleic acid. It is the genetic material of almost all organisms, except a…
Q: If DNA sequence is CCGACG what would be the amino acid sequence ( read from left to rig TRNA…
A: The process of decoding the genetic code contained within a messenger RNA (mRNA) molecule to produce…
Q: is the term used to describe the genetic code because there is more than one codon that specify for…
A: 7. Denaturation is the process of separating two DNA strands into two single strands. Therefore…
Q: Histones are a family of positively charged proteins binds tightly with negatively charged, DNA,…
A: Histones are basic proteins that are found inside the nucleus of eukaryotic cell. These proteins…
Q: The site of post-translational cleavage of biologically active proteins is often ma O methylated…
A: Protein post-translational modifications (PTMs) increase the functional diversity of the proteome by…
Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…
A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…
Q: AAA CC GG G CA GG CCGU Phe Gly Arg
A: * Transcription is the process of copying DNA segment into RNA. *The DNA segments transcribed into…
Q: he best definition of an endonuclease is that it hydrolyzes A. nucleotide from only the 3' -end of…
A: Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Some…
Q: DNA G CU MRNA T U GOOC ERNA fethionine Amino Acids NA is synthesized in translation or…
A: Transcription is the process in which DNA forms m RNA and translation is a process in which protein…
Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…
A: Hello, thank you for your question. The second part of the question seems to be incomplete,…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: A certain template DNA strand has the following nucleotide sequence:…
A: Nucleotides can be described as the nucleic acids’ building blocks. The two forms of nucleic acid…
Q: T A C C A G A T A C A C T C C C C T G C G A C T into an mRNa sequence and a…
A: The central dogma explains the flow of genetic information from DNA to RNA and then to protein. It…
Q: The genetic information contained in DNA consists of a linear sequence of coding units known as…
A: From the given case, it is known that the E. coli DNA has a size of 4.70 X 106 bps. As, it is given…
Q: transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain,…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to…
A: The transcription is the process by which RNA is produced from the temple strand of the DNA. Then…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.Translate the following DNA sequence into amino acids 5'ATAGTACCGCAAATTTATCGCT3 O met-ala-phe-lys-stop O met-ala-phe-lys- met-tyr-his-gly-val-stop-met-gly O met-ala-ser-gly-thr-stop O tyr-his gly-val-stop-met-ly O ala-phe-lys stopWhich amino acid sequence will form part of which protein structure, and why? Sequence 1: Ser-Phe-Gln-Val-Lys-Leu-His-Tyr-Asp-Val Sequence 2: Glu-Tyr-Leu-Asn-Phe-Ala-Gln-Val-Leu-Arg __Amphipathic beta strand __ Amphipathic alpha helix
- otein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. SubmitChanging one amino acid within a protein sequence from a tryptophan to a stop codon would be best classified as Amino acids groups Group Characteristics Names Ala, Val, Leu, Ile, Pro, Phe Trp, Met Ala: A Leu: L non-polar hydrophobic Arg: R Asn: N Lys: K Met: M Asp: D Cys: C Gly: G polar hydrophilic (non-charged) Gly , Ser, Thr, Cys, Tyr, Asn Gln Phe: F Pro: P Ser: S acidic negatively charged Asp, Glu Glu: E Gln: Q Thr: T His: H lle: I Trp: W Туr: Y Val: V basic positively charged Lys, Arg, His A) Conservative missense O B) Nonsense O C) Neutral O D) Non-conservative missenseGiven the structures of the ribonucleotides and deoxyribonucleotides: Adenine Uracil Thymine HN Adenine NH HO-P-0- CH2 HO-P-0 CH2 HO-P-0-CH2 HO-P-0-CH он он он он OH H OH H Cytosine Cytosine Guanine Guanine NH2 NH NH2 CH2 HOo CH2 HO-P-0 -CH2 он он он он OH H OH H • Draw the structure of the polyribonucleotide UAGCCUG. Draw the structure of the polydeoxyribonucleotide CGTAGAT.
- (ol soupe bannos96 SAM 3 A small strand of DNA has this sequence: 0pxbeter owl nade hoparg TACCGGAAACTG ATGGCCTTTGAC a. If the TOP strand is the template strand, what will be the mRNA made from this DNA read from left to right? What process allows for the mRNA to be made? b. If this is a eukaryotic mRNA, where does transcription occur? What would happen if the mRNA was not processed? c. What is the sequence of the protein made (use the genetic code below)? What process allows for the protein to be made?Glycosylation is a major type of protein post-translational modification. Identify the amino acid that is joined to each monosaccharide by a glycosidic bond. glycoprotein A glycoprotein B glycoprotein C HA HO Н CH₂OH HO OH Н H CH₂OH Н ОН HO HN-C-CH3 о c=0 NHI -NH-C - CH2C-H ОН Н нн ОН НН CH2OH Он OH HO Н NH 1 С=0 -CH2-C-н NH C=0 LO-CH2-C-H NH A В с10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
- One common secondary structure found in proteins in the a-helix. On the diagram below is an a- helical region of the enzyme lysozyme. The sequence of this region is: NH Arg - Cys - Glu - Leu - Ala-Ala-Ala-Met-Lys. COO- 0 0 on the top 0 on the bottom R Is the N-terminus on the top or on the bottom of this diagram? RRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…A polypeptide is digested with trypsin, and the resulting segments are sequenced: Val-Gly Ala-Ala-Gly-Leu-Trp-Arg Arg-Asp-Pro-Gly-Lue-Met-Val-Leu-Tyr-Ala-Ala-Asp-Glu-Lys And the following fragments are produced by chymotrypsin fragmentation: Ala-Ala-Gly-Leu-Trp Arg-Arg-Asp-Pro-Gly-Leu- Met-Val-Leu-Tyr Ala-Ala-Asp-Glu-Lys-Val-Gly What is the sequence of the whole original polypeptide? (Recall that trypsin cleaves a polypeptide backbone at the C-terminal side of Arg or Lys residues, whereas chymotrypsin cleaves after aromatic amino acid residues).
