Translate the following mRNA codons: 5' AAG UGG CAU ACG - 3' Write your answer in order (first codon corresponds to the first blan-

Q: How many different mRNA sequences can encode a polypeptide chain with the amino acid sequence…

A: Polypeptide chain includes a sequence of amino acids that are coded by different codons during the…

Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: TRACE THE CODE| Order of bases in MRNA (codon) AUC Order of bases in ERNA (anticodon) Order of bases…

A: Complete this table of codes.

Q: From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change one base in codon 8 to…

A: The genetic material of the cell, that is, the DNA (deoxyribonucleic acid) comprises various coding…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: Write all the possible mRNA sequences that can code for a simple tripeptide segment Leu-Trp-Glu.…

A: Translation is the process of conversion of mRNA to protein . In this , Each codon is basically a…

Q: A DNA codon of ATT is complementary to UAA this RNA codon. This codon terminates a coding region.…

A: Codon can be defined as the trinucleotide sequence of DNA or RNA which corresponds to a specific…

Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…

A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…

Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…

A: CODON-  It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.

Q: Directions: Transcribe the DNA sequence in the space provided. Use your notes and what you know.…

A: Transcription  A process of making of mRNA from DNA. mRNA contain information about polypeptide…

Q: The circled portion labeled Y is known as a(n): O ribosome O DNA molecule codon TRNA molecule O…

A: The translation occurs in the cell's cytoplasm. Firstly, a nascent mRNA or pre-mRNA synthesized by…

Q: Send A PEETRAS O

A: Transcription  is the process of formation of RNA from the DNA.The transcription process takes place…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: Which of the following codons is not a termination codon for protein synthesis?a) UUUb) UAGc) UAAd)…

A: UUU is not a termination codon for protein synthesis. Hence option a is the right answer UUU codes…

Q: Complete the table below showing the sequences of DNA, MRNA codons, RNA anticodons and the amino…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: 3. Using your Genetic Code, translate and group the following MRNA bases. Example: UAC CAG UGG UUU…

A: a. 5 'CUC GGU ACG UAA UAG AUC UAU CAU CCG AGA CUC UUA AAU 3' ANSWER:  5' Leu Gly Thr Stop Stop Ile…

Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…

A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…

Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…

A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides.  We…

Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA

A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…

Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…

A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…

Q: The tRNA for Phe binds to the mRNA codon UUU. You mutate the anticodon of the Phe-tRNA from AAA to…

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: An anti-codon is on what kind of molecule? O DNA O TRNA O polypeptide O MRNA

A: An anticodon is a tri-nucleotide sequence which is complementary to the codon sequence present on…

Q: What is the sequence of the peptide that would result following translation with a ribosome?…

A: Translation is the process in which the mRNA is converted into a long chain of polypeptide called…

Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…

A: During transcription process RNA is formed with the help of complementary base pairing with template…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: Each combinations of nitrogen bases on the mRNA molecule is a codon, which is a three letter code…

A: 4) tryptophan- UGG 5) Leucine- CUU, CUC, CUA, CUG

Q: Write the amino acid sequence based on the following portion of MRNA. Write the name of the amino…

A: The codons which are present on mRNA are will code for specific amino acids based on genetic code…

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: Follow the path of codons to discover the peptide and unlock the Directional Multilock. (Hint: type…

A: Peptide formed from given mRNA sequences.

Q: 2. Transcribe the following gene sequence to the appropriate MRNA codons: TCA TTT cCA CAG ACA * AGU…

A: Transcription is defined as the process of RNA formation from the template strand of DNA by the…

Q: hange the peptide to Met Asp Asn Gly Leu Gly ?    Use the codon numbers to help describe where the…

A: Since you have posted a question with multi- sub parts , we will solve first three sub-parts for…

Q: For a TTT triplet of bases in the template sequence of DNA, the anticodon on the TRNA that binds the…

A: The anticodon is a trinucleotide sequence found on tRNA that controls which amino acid it…

Q: Most codons specify a(n)____ . a. protein c. amino acid b. polypeptide d. mRNA

A: A codon may be defined as a tri-nucleotide sequence of DNA or RNA that for a specific amino acid.…

Q: AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons…

A: Introduction When DNA makes the same copy of itself then it is called replication. Each replicated…

Q: AAA CC GG G CA GG CCGU Phe Gly Arg

A: * Transcription is the process of copying  DNA  segment into RNA. *The DNA segments transcribed into…

Q: The following sequence represents triplets on DNA:TAC CAG ATA CAC TCC CCT GCG ACT a. Give the mRNA…

A: Hello, thank you for your question. The second part of the question seems to be incomplete,…

Q: If the codon for Histidine is 5' CAU 3' in an MRNA molecule, the anticodon on the TRNA is: UAC ATG…

A: In every group of messenger ribonucleic acid (mRNA), there are three bases. A codon is also there…

Q: . ) In one (1) sentence point out a key structural similarity and difference in each of the…

A: Biomolecules are abundant biological molecules present in the body like carbohydrates, proteins,…

Q: Which statement about transfer RNA (TRNA) is NOT correct? Select one: O It folds up into the shape…

A: Transcription in the process which is responsible for synthesis of RNA from the template strand of…

Q: Here is a DNA sequence that codes for an extremely short protein. 3' TTACGTGCCGATCGAA 5' template…

A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…

Q: The first MRNA codon to specify an amino acid is always Phe Leu (F) (L) Glu Asp (E) (D) Ser (S) Tyr…

A: A gene is a DNA-based functional heredity unit that delivers instructions for the production of RNA…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…

A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…

Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…

A:

Q: 8. Codons are sequences that correspond to specific amino acids or signals during protein…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: The mRNA codon of valine is GUC UGG CCA TTG

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…