TRANSCRIBE this DNA sequence: TACGTTACT O AUGCAAUGA OATGCAATGA AUGGATUGA TACGTTACT

Q: Second Base Analyze the following DNA sequences: A UUU UCU UAU UGU Phe Tyr UUC UCC UAC UGC Original:…

A: So, the given information is:- ORIGINAL- AGAGAGAGAGAGAGAGAG…

Q: digest suspect B's DNA using restriction enzyme 1. Restriction enzyme 1 cleaves the recognition site…

A: The restriction enzymes are endonucleases that digest DNA (deoxyribonucleic acid) molecules by…

Q: Question 41 What is specifically illustrated in the figure below? Self- complementary sequence RNA…

A: In the image shown, we can see two strands of DNA, unwinded, RNA polymerase, RNA being transcribed…

Q: answer question 2 please  asap

A: Polymerase chain reaction (PCR) can amplify a single target DNA fragment from a complex mixture of…

Q: 9. The following DNA sequences found on the sense strand belong to the same eukaryotic gene:…

A: DNA or Deoxyribonucleic Acid acts as the genetic material of biological entities. It is made up of…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Deoxyribonucleic acid is a molecule made out of two polynucleotide chains that curl around one…

Q: econstruct the corresponding DNA template sequence from the partial mRNA sequence…

A: It is a double-stranded molecule made of nucleotides which are made from a nitrogenous/ organic…

Q: Nde I EcoR I Sal I Kpn I BamH I PUST MCS ori Xho 1- Ampe BamH I Kpn I EcoR I BamH I gene W Xhe

A: Introduction  A chemical reaction is a process in which the reactants are converted into a product…

Q: You are interested in the rapid mutation rate of the polymerase of a virus XY, that inserts its…

A: The mutation changes the amino acid at the third position. Specifically, it changed from Glycine…

Q: What is incorrect in the diagram shown below? Nascent DNA DNA Template 5.707. •Motototol. G dTMP PP₁…

A: NTP has three phosphate groups attached to the 5' carbon of a sugar.These are the building blocks of…

Q: How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below.…

A: The question inquires about the Sanger sequencing method, a strategy utilized to decide the grouping…

Q: A researcher wants to cut this piece of linear DNA. 5 AGCTAGTCCGGATCCGAGGGCCCTTCTCATGAGATCCGGATGACC…

A: The discovery of restriction enzymes in 1968 by Swiss scientist "Werner Arber" ushered in the era of…

Q: What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGELLGTATAL -5…

A: DNA replication :-  It is the formation of a new DNA from a pre existing DNA.  The DNA so formed is…

Q: Table 4. Ligation of Sequencing adaptor to digested genomic DNA Components Amount Mspl or…

A: Dilution Factor (DF) can be expressed as ratio of volumes and as ratio of concentrations. DF…

Q: 18. You want to express hemoglobin beta (HBB) in a bacteria model using a vector. You would like to…

A: PCR (Polymerase Chain Reaction) is a laboratory technique used to amplify specific regions of DNA.…

Q: 4) Consider three different kinds of human libraries: a genomic library, a brain cDNA library, and a…

A: Genomic deoxyribonucleic acid (gDNA) is representative of the chromosomal DNA present in the cells…

Q: Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the…

A: With bioinformatics techniques like BLAST, it is often possible to determine a gene from a DNA…

Q: C RNA 5' UGGU I III II ACCAT CAGTC A G II TEMPLATE DNA 5' RNA polymerase

A: Transcription: Formation of mRNA from DNA with the help of enzyme RNA polymerase.

Q: How many nucleotides are in the consensus coding sequence (CDS) of the KMT2D transcript?

A: A consensus coding sequence (CDS) is a method used in next-generation sequencing (NGS) to identify…

Q: following question is related to Restriction Enzymes and RFLP. Using EcoRl, which DNA sequence held…

A: Restriction enzymes, also known as restriction endonucleases, are a key tool in molecular biology.…

Q: be used for a restriction fragment length polymorphism (RFLP) diagnostic assay to identify…

A: Polymerase chain reaction, or  as we say PCR, is a technique used to make many copies of a specific…

Q: Match the term with the correct description. satDNA                                  STRs…

A: INTRODUCTION Tandem repeats These are short segments of DNA that can repeat many times within a…

Q: Order the following steps according to the Sanger sequencing method The bands in the electrophoresis…

A: DNA sequencing is a technique used to evaluate the exact nucleotide bases , their position as well…

Q: Consider the following four DNA sequences taken from the a homologous gene from four different…

A: Multiple sequence alignment is majorly used to find out evolutionary relationship between…

Q: Write the complementary sequence of DNA AGCTAT AGC

A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…

Q: Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their…

A: DNA cloning restriction sites are specific DNA sequences recognized and cleaved by restriction…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: Summary table of data for one yeast DNA microarray. Shows 14 of the 6,200 genes on the full…

A: A DNA microarray also known as a DNA chip or gene chip is a high throughput technology used to study…

Q: Which of the following molecules|are involved in gene expression? Choose all that apply. O RNA…

A: Nucleic acid such as DNA is the major carrier for genetic information in almost all living…

Q: Based on the images attached, what does the similarity in the sequences tell you about the ermB gene…

A: A cladogram is a branching tree diagram that depicts a phylogeny estimation of the evolutionary…

Q: please select the gene type is INCORRECTLY matched with its type of genomic sequence. 1. TRNA gene:…

A: The answer is given below,

Q: Based on these sequences. Remove codons 24 to 66, inclusive. Sequence A…

A: The enzyme complex responsible for this excision is known as splicesome. Splicesomes are complicated…

Q: expalin Yeast centromeric DNA sequences

A: Centromere, also known as kinetochores are DNA sequences that are involved in linking a pair of…

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following…

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C…

Q: Bradley did two test PCR experiments with his phage genomic DNA. For one experiment he used G…

A: For categorizing phages, the term 'clusters' is used for groups of similar phages. It aids in…

Q: translate the following DNA sequence of the coding strand: 5'-ATGGCCCGGTTATAAGCA-3'

A: Determination: Translate  and transcribe DNA sequence

Q: Design primers for PCR that would be able to amplify this entire DNA fragment.  -Design the primers…

A: AThe primer sequence is as follows: FORWARD PRIMER: 5' GCTCAGG 3' REVERSE PRIMER: 5'TCTATTA3'

Q: Transcribe the DNA sequence that follows. What type of molecule did you make? How many codons are…

A: DNA is made up of nitrogenous bases, deoxyribose sugar, and phosphate. DNA acts as genetic material…

Q: answer that attaced question

A: Restriction endonucleases are enzymes that act as molecular scissors and cut the DNA molecule at a…

Q: which one is forward primer and which one is reverse primer

A: In order to make multiple copies of a double stranded DNA, two primer molecules are required; the…

Q: Can you explain this dna model

A: DNA is made up of sugar ( deoxyribose) , nitrogenous bases ( thymine, cytosine, adenine and guanine)…

Q: Using the skills you learnt in the DNA Analysis tutorial, correctly identify the gene and the…

A: The method of identifying the nucleotide code - the sequence of base sequence – is known as DNA…