I want to ask which one is forward primer and which one is reverse primer QuikChange II3. Find your DNA sequence by pressingLoad a file from your hard-drive:No file selected4. Load it.DNA: changenucleotide(s) to:orUpload Now -or- Upload Translatedor specify a DNA region to translate from.Select up to seven nucleotides that you want to change OSite 1Site 2U1aagilent.com/store/ +Insert between two checked nucleotides10 a19 g28 a37 g2111 aBrowse20 a29 c38 torO Delete a region between two checked nucleotides (Note: two checked nucleotides will not be deleted)c289c_g290a_c291t3g12 a21 a30 t39 c48 t57 a66 t75 g84193146 c47 t55 t56 t64 g65 a73 g74982 t83191 a92 gFinally, obtain your designed primer sequences.Design PrimersClear this form to load a new sequence:Clear InputPrimer sequences:Primer Namec289c_g290a_c291tOligonucleotide information:Primer Namec289c_g290a_c2911Primer-template duplexes:Primer NameOr, paste plain text or FASTA-formatted DNA sequence in the box below:atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagettaccettaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgataccettattaatcatatcoaattaaaaaatattaattttaaaaaaaataaaaacattctcLength (nt.)4747Primer-Template Duplextgecatgeccgaag3-gtacgE5-catgeo|||||ABOUT AGILENT RESOURCESacggtaHelp in choosing a mutagenesis kitgtacgggetCONNECT WITH AGILENT f in4913 g22 c31 g40 c49 g58 g67 g76 cSite 385194 g▾Tm78.59°C78.59°CtoL5cSite 4V14 g23 tO 32 g41 c50 t59 a68 t77 a86 c95 gPrimer Sequence (5' to 3)5-catctttgaaagatatagtatgttcctgtacataaccttcgggcatg-35-catgcccgaaggttatgtacaggaacatactatatctttcaaagatg-3YSite 5AGILENTSOCIAL HUBSHOPPING TOOLS SUPPORT &6115 a24133 a42 a51 160 t69t78 c87 t96 aDuplex Energy at 68 "C-48.57 kcal/mole-49.09 kcal/moleSite 67a16g25134 g43 a5 :52 g61 g70 a79 a88 g197 gUpload Translated RegionSite 7L8g17 a26t35 t44153 a62 g71 a80 a89 t98 aaagatgacg||||||tttctac-51tg-31Yetge9c1827364554637281Energy Cost of Mismatches11.31%12.42%9099Follow UsAmiler

In order to make multiple copies of a double stranded DNA, two primer molecules are required; the…

Answered: which one is forward primer and which…

Science

Biochemistry

which one is forward primer and which one is reverse primer

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

What is the Lineweaver-Burk plot and what does it tell us?
3 attempts left Check my work Be sure to answer all parts. Re Consider the following sequence of DNA: 3'-AGA CCC-5'. a. What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CCC to CCA in DNA, what dipeptide is formed? Gu c. If a mutation converts CCC to CGC in DNA, what dipeptide is formed? d. If a mutation converts CCC to GCC in DNA, what dipeptide is formed? a. b. c. d.
Where is the substitution indicated on the original DNA strand? May you please Write it out and bold the nucleotide.
HN N C N H₂N HN پرسپولیو D B CH₂ -N N NH₂ E When part of a nucleotide in a nucleic acid chain, which of the following may base pair with thymine nucleotides? Choose all correct answers and assume normal Watson-Crick base pairing.
please help me complete this table, I have done mine, so I need correct answer to match with.
You have a locus in your PCR reaction that is a DNA sequence, is on the fifth chromosome, is a single copy locus, and has sequence ID #818. What would its name be according to ISFG nomenclature?
For the hybridization step in the Southern blotting, the hybridization was done at 85 degrees Celsius instead of 58 degree Celsius. Explain how this would affect my results.
BamHI KpnI SpeI XhoI PatI HindIII 400 500 200 300 700 NotI 75 2580 ECORI Frog DNA BamHI 575 KpnI HindIII 625 2150 HindIII 700 PstI clal 750 РКАВОО 2700bp 915 1900 SpeI AluI 1050 1525 BamHI ori You wish to make a recombinant DNA molecule that will contain one piece of pKABOO vector DNA and one piece of frog DNA so that you can clone a segment of frog DNA. You want cells containing your recombinant plasmid to be amp' and tet and you want to use enzymes that cut within the insertional marker gene. (Note that tet means that there is no functional tet gene in the plasmid.) Be sure that your plasmid has the ability to replicate autonomously in a bacterial cell. You do not have to include the entire frog DNA given below in your recombinant plasmid. Restriction enzymes would be used to clone segment of frog DNA The size of the recombinant plasmid is bp. The recombinant plasmid when transformed into E. coli confers resistance to which of the following antibiotics: Oampicillin only Otetracycline…