I want to ask which one is forward primer and which one is reverse primer QuikChange II3. Find your DNA sequence by pressingLoad a file from your hard-drive:No file selected4. Load it.DNA: changenucleotide(s) to:orUpload Now -or- Upload Translatedor specify a DNA region to translate from.Select up to seven nucleotides that you want to change OSite 1Site 2U1aagilent.com/store/ +Insert between two checked nucleotides10 a19 g28 a37 g2111 aBrowse20 a29 c38 torO Delete a region between two checked nucleotides (Note: two checked nucleotides will not be deleted)c289c_g290a_c291t3g12 a21 a30 t39 c48 t57 a66 t75 g84193146 c47 t55 t56 t64 g65 a73 g74982 t83191 a92 gFinally, obtain your designed primer sequences.Design PrimersClear this form to load a new sequence:Clear InputPrimer sequences:Primer Namec289c_g290a_c291tOligonucleotide information:Primer Namec289c_g290a_c2911Primer-template duplexes:Primer NameOr, paste plain text or FASTA-formatted DNA sequence in the box below:atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagettaccettaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgataccettattaatcatatcoaattaaaaaatattaattttaaaaaaaataaaaacattctcLength (nt.)4747Primer-Template Duplextgecatgeccgaag3-gtacgE5-catgeo|||||ABOUT AGILENT RESOURCESacggtaHelp in choosing a mutagenesis kitgtacgggetCONNECT WITH AGILENT f in4913 g22 c31 g40 c49 g58 g67 g76 cSite 385194 g▾Tm78.59°C78.59°CtoL5cSite 4V14 g23 tO 32 g41 c50 t59 a68 t77 a86 c95 gPrimer Sequence (5' to 3)5-catctttgaaagatatagtatgttcctgtacataaccttcgggcatg-35-catgcccgaaggttatgtacaggaacatactatatctttcaaagatg-3YSite 5AGILENTSOCIAL HUBSHOPPING TOOLS SUPPORT &6115 a24133 a42 a51 160 t69t78 c87 t96 aDuplex Energy at 68 "C-48.57 kcal/mole-49.09 kcal/moleSite 67a16g25134 g43 a5 :52 g61 g70 a79 a88 g197 gUpload Translated RegionSite 7L8g17 a26t35 t44153 a62 g71 a80 a89 t98 aaagatgacg||||||tttctac-51tg-31Yetge9c1827364554637281Energy Cost of Mismatches11.31%12.42%9099Follow UsAmiler

In order to make multiple copies of a double stranded DNA, two primer molecules are required; the…

Answered: which one is forward primer and which…

Science

Biochemistry

which one is forward primer and which one is reverse primer

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

if i had 3 sequences that were 15 nucleotides long. how would i make an optimal sequence alignment using gaps?
Below is a schematic of the molecule that inserts the fourth amino acid (a trytophan) into the mutant polymerase. A codon chart is found on the final page of the exam. i) This schematic represents a _________ ii) On the schematic, give the nucleotides of the anticodon. Justify your answer
What are the reasons why there needs to be more than 10 cycles in the PCR process? Name 2 reasons.
The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is shown which is ok for our purposes (but remember that the other strand would also be present in DNAà but it is ok for us to ignore). This is very similar to a problem on the old tests. For each letter state the structure or the function of what occurs at that region. Letter A is Letter B is Letter C is Letter D is Letter E is Letter F is Letter G is To which region/letter would RNA Polymerase bind To which region/letter GTF bind Label the position of the start codon ATG and the stop codon TGA The picture below is for the question itself
What is one of the end results of site-specific recombination? Diagram your answer and answer in 1-2 sentences.
2(a) iv
Listed below are 4 of the 13 genome sites used to create a standard DNA profile. Each site consists of a number of short tandem repeats: sets of 4 nucleotides repeated in a row within the genome. For each site, the number of repeats found at that site for this individual are listed: Imagine you perform a PCR procedure to create a DNA profile for this individual. Which of the following four gels correctly represents the DNA profile of this person?
I been having a hard time finding an article relates to gene linkage. That have these requirements: 1. Must be peer reviewed Journal article (not a review article). 2. The article must have been published not later than January 2020 or has to be present year (year: 2024)
Would you be able to draw a circular map of the seven genes? I have trouble with correct position of the genes
Instructions: — Please answer properly — Donot copy here in Bartleby or in Google.
As the leading scientist in a biomedical science laboratory, it is a requirement to give advice to your lab assistants when they are having problems with their experiments. What advice would you give to your assistants that are having the following problems: After performing a polymerase chain reaction (PCR) and agarose gel electrophoresis to confirm the presence of the C01 gene of 750bp. 2.1. They observe no band appearing on an agarose gel. What would be your conclusion? 2.2. They observe three bands of different sizes that resemble a smear on the gel. Advice 2.3. They observe a single band on the gel and conclude that the PCR product is an exact copy of the original template DNA. Would you support their condusion? Explain. 2.4. Explain how PCR can be used to detect infectious agents in diagnoses of diseases.
What is difference between normal primer and degenerative primer?