Answered: Check the new protein created by your…

Check the new protein created by your new DNA. Describe how this changed the protein (amino acid sequence).BTW- I added a T after the first triplet so it should read ATGTCC.

Essentials of Pharmacology for Health Professions

7th Edition

ISBN:9781305441620

Author:WOODROW

Publisher:WOODROW

Chapter9: Administration By The Parenteral Route

Section: Chapter Questions

Problem 9CRQ

See similar textbooks

Related questions

Q: 5'-AAAAACCCCCGGGGGTTTTT-3' is in a test tube. What else needs to go in the test tube to so that we…

A: Here it is not mentioned that how the single stranded DNA is maintained. As the single strand…

Q: 5. 2) Digestion of a 1.1kb fragment of plasmid DNA with BamHl produces two fragments of 700 bp and…

A: BamHI is a type II restriction endonuclease can identify specific restriction site and induce cut on…

Q: You are interested in the rapid mutation rate of the polymerase of a virus XY, that inserts its…

A: The mutation changes the amino acid at the third position. Specifically, it changed from Glycine…

Q: Describe the function of DNA polymerase. Explain why each part of the name DNA polymerase (DNA,…

A: DNA polymerase DNA is replicated by enzymes known as DNA directed DNA polymerases or simply DNA…

Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…

A: given are some statements regarding polynucleotide formation and the correct among them is given…

Q: Write the sequence of a different six nucleotide palindromic DNA sequence that uses all four…

A: Palindromic DNA sequences are read the same on both DNA strands from the similar end. For example,…

Q: Please use the below DNAs and complete 4 steps question. Thanks1

A: Replication : It is the biological process of producing two identical replicas of DNA from one…

Q: You have found a new base analog. It looks to the cell like an A, but it can also change shape and…

A: A mutation is a change occurring in a DNA sequence. These can result from DNA copying errors during…

Q: The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the…

A: Plasmid vectors are circular and extra chromosomal DNA which are capable of self-replication.…

Q: Cells contain both DNA and RNA. What difference between the structures of these nucleic acids (that…

A: The DNA and RNA are nucleic acids found in the cells. DNA is present in the nucleus while RNA can be…

Q: 9. (2) Here is a sequence of double stranded DNA. Choose a pair of primers to amplify gene X.…

A: Polymerase Chain reaction or PCR is a rapid in vitro technique for amplifying target DNA…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of…

A: Sickle cell anemia is a disease caused by a mutation of the gene coding for hemoglobin leading to…

Q: Check the new protein created by your new DNA. Describe how this changed the protein (amino acid…

A: Any change in the DNA is called mutation. Some Mutations are beneficial because they add on the…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure…

A: DNA It is a biomolecule that carries genetic information and information for the process of protein…

Q: You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and…

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl…

A: DNA polymerase is a main enzyme for DNA replication.. The two main requirements for working of DNA…

Q: a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS…

A: DNA replication is a phenomenon in which DNA make itself using Enzyme DNA Polymerase . It occurs in…

Q: rect! You perform a Sanger sequencing reaction. The template strand is: 5' ATCGAAC 3' However, you…

A: Sanger sequencing, also known as chain termination sequencing, is a DNA sequencing method developed…

Q: Provide the sequences of the template and coding strands of a DNA double helix that was used to…

A: Introduction :- The template strand is a strand of DNA that serves as the blueprint for the…

Q: Describe the base-pair rule. - What three things make up a nucleotide? - What does anti-parallel…

A: 1.Base pair rule: This rule in DNA states that purines (A,G) should bind with pyramidines (T,C) the…

Q: a. what is the nucleotide sequence of the DNA chain synthesized from the primer. label the 5' to 3'…

Q: The line below depicts a DNA segment from a eukaryote. In this case, only the top, coding strand, is…

A: Eukaryotic DNA is enclosed within a double membrane bound nucleus. In eukaryotic transcription,…

Q: Using the figure below, what is molecule "A" (type a 1, 2 or 3 in the blank)

A: This question is based on the Dna replication.

Q: All ingredients required for the synthesis of DNA were placed in a test tube. The primer has the…

A: This is the working process of DNA dependent DNA polymerase. DNA polymerase synthesize new DNA…

Q: 5’-GATCAGCTGACTGGATCCGTCCTCAACGTCAGGATCCAGCTTCAAG-3’ 1. How many cuts do you expect this enzyme to…

A: Some enzymes are called endonucleases cleave the phosphodiester bonds that exist in the DNA. Some…

Q: Hhal is a 4-cutter restriction enzyme that creates 2-base, 3' overhangs ("sticky ends") and…

A: Restriction enzymes can cleave the DNA sequences at the recognition sites, also known as restriction…

Question

Check the new protein created by your new DNA. Describe how this changed the protein (amino acid sequence).BTW- I added a T after the first triplet so it should read ATGTCC.

Thanks

Normal AA: ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG
New AA: ATGTCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG
What changed?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The term meaning pain in a nerve or nerves is ________________________________.
Ginas physician ordered laboratory tests that would enable him to establish a differential ________________________________to identify the cause of her signs and symptoms.
The term meaning pain in a joint or joints is _______________________________ . arthralgia arthritis arthrocentesis artherosclerosis
How would you feel if your child were in a class Hernani was teaching or on one of the teams, he was coaching? Why?
The term ___________________________ means the tissue death of an artery or arteries. arteriomalacia arterionecrosis arteriosclerosis artheriostenosis
An ________________________ is a malignant tumor that originates in glandular tissue. adenocarcinoma adentitis adenoma adenosis
It was determined that AirFreight was not responsible for the accident. Therefore, do you think the company should take away Sandors job if he does not return in 30 calendar days?