The RI2IM mutant complex I has the ability to accept protons but cannot pass them to ubiquinone. Assume mitochondrial membranes are assembled containing the R121M complex I, plus wildtype complexes II, III, IV and V. If FADH2 is provided, which complexes will be reduced? Circle all that apply a. R121M Complex I b. Complex II c. Complex III d. Complex IV e. Complex V None of the complexes will be reduced f.

Q: Molecular genetic studies are performed on a family with known familial hypercholesterolemia. In…

A: The question is asking about the likely effect of a mutation in the LDL receptor gene, specifically…

Q: Huntington's disease (HD) is an autosomal dominant, 12 neurodegenerative disorder caused by a…

A: Huntington's disease (HD) may be a progressive encephalopathy caused by a defective gene. This…

Q: What would be the effect on the cell cycle if a cell acquired a mutation that rendered each of the…

A: The cell cycle is a series of events that take place in a cell as it grows and divides. A cell…

Q: under what conditions would it have Beta galactosidase activity? JAlith

A: Beta galactosidase work with lactose

Q: Describe the different secondary structures in each model

A: Secondary structure Secondary structure means, the arrangement of amino acid residues in a…

Q: 26.With regard to cell signalling, which of the following do not represent exogenous signals?   A.…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: Which is a phenotype associated with mutations in ATP synthase? Figure 1.jpg      longer than…

A: The mutation is the random change in the genome of an organism.

Q: Which of the following conditions are required for the Eve protein to be expressed in the cells that…

A: Apoptosis is defined as a form or type of programmed cell death that will occur in multicellular…

Q: A point mutation in Hb diminishes hydrophobicity at the heme. Which of the following impacts would…

A: Hb hemoglobin carries O2 in the blood during the gaseous exchange.

Q: Match the mutation in the trpL leader sequence with the correct phenotype of the mutant. A. The TRP…

A: Introduction The trp operon is a collection of genes found in E. coli bacteria that code for…

Q: A mutant haploid strain of Saccharomyces cerevisiae(yeast) called cox2-1 was found that was unable…

A: Cycloxygenase (COX-2) are enzymes that produce prostaglandins, and act as pro-inflammatory…

Q: Both Pfizer and Moderna MRNA vaccines use the lipid DSPC (see figure below) in constructing the…

A: The vaccines are the specific molecules that helps us developing passive immunity. Vaccination helps…

Q: Expression of yeast GAL genes are regulated by Mig1. A Mig1 mutant was identified that could not be…

A: Gal gene expression is subjected to exposure of galactose as well as combination of certain…

Q: 1. Know the structures of DNP-glycine and of the chromophore associated with cytochrome C. Low Salt…

A: In chromatography, the molecules are separated based on their interactions with the stationary and…

Q: a. In active muscle cells, the pO2 is about 10 torr at the cell surface and 1 torr at the…

A: Myoglobin and hemoglobin are oxygen storage and transport proteins. Myoglobin, whose primary…

Q: The biogenesis of functional mitochondria is dependent upon the products of both nuclear and…

A: Mitochondria are the membrane-bound cell organelles that generate most of the chemical energy needed…

Q: 3). Consider the four mutations (i-iv) described below: i. One of the mutations causing cystic…

A: A mutation is a permanent change in the DNA sequence of an organism's genome. Mutations can occur…

Q: 1. Hexokinase (HK) catalyses the conversion of glucose to glucose-6-phosphate. There four distinct…

A: The very first reaction of glycolysis is catalyzed by the enzyme Hexokinase where it converts…

Q: APC is a ubiquitin ligase activated by M-cyclin Cdk What is the function of APC when bound to…

A: An integral regulator of cell division that is encoded by the CDC20 gene in humans is the cell…

Q: If GUS is present in the Arabidopsis Thaliana plant , what does that mean

A: The GUS gene is a reporter gene for jb diverse plans in bacterial species. The gene encodes for…

Q: Determine the reason due to which it is possible that the translation of a single mitochondrial…

A: Given that tRNAs are impacted by numerous clinical mitochondrial illnesses brought on by mutations…

Q: The human mitochondrial genome includes no genesfor tRNA synthetases. a. How are mitochondrial tRNAs…

A: Mitochondria refer to membrane-bound organelles found in most eukaryotic cells. These organelles…

Q: 5. ( Polyphenoloxidase is involved in the darkening of wheat products due to its oxidative effect on…

A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…

Q: Which complex is the only complex from the respiratory pathway that has noproteins encoded by the…

A: The complex II in the respiratory chain is encoded only by nuclear genes. The proteins for other…

Q: Bacterial ATP synthase genes are composed of ? O A. a Fo intermembrane portion and a F1…

A: Introduction:- Oxysomes are little circular structures found within the folds of the inner…

Q: How are proteins normally transported into a plant cell’s chloroplast, if they were originally…

A: Chloroplast is a organelle exclusive to plants and some photosynthetic organisms. It is a kind of…

Q: Four different histidine auxotrophs of Neurospora, a eukaryotic mold, are tested fol histidine and…

A: Microbes almost synthesize all the essential biomolecules required for their growth. Auxotrophs are…

Q: A mutant haploid strain of Saccharomyces cerevisiae(yeast) called cox2-1 was found that was unable…

A: It is given that a mutant strain of Saccharomyces cerevisiae called cox2-1 lack a mitochondrial…

Q: 8. Hers discase (type IV) is a rather rare type of glycogenosis inherited in an autosomal recessive…

A: Mutations in the PYGL gene cause Hers disease. The PYGL gene provides instructions for making an…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: 1. A yeast variant was discovered that had a shorter glycolytic pathway. This "mutant" yeast made a…

A: Metabolic pathways are the set of biochemical reactions catalyzed by the set of enzymes. The product…

Q: Design a set of experiments using chimeric proteins, composed of a mitochondrial precursor protein…

A: Methotrexate acts as a substitute for the enzyme dihydro folate reductase ( DHFR). This is a DHFR…

Q: E. For the two mechanisms of apoptosis that do require cytochrome c release, which requires caspase…

A: Definition of Apoptosis:  Apoptosis is form of programmed cell death which  begins when a cell…

Q: Describe an experiment that shows if early mouse embryo inner cell mass cells containing…

A: An experiment that demonstrates whether the inner cell mass of an early-stage mouse embryo contains…

Q: Explain the action of the mitochondrial uncoupling protein

A: An uncoupling protein (UCP) is a protein present in inner mitochondrial membrane.

Q: 5. In class we described two post-translational modifications which could be used to control…

A: The enzymes are the proteins. They are coded by the gene sequences present in the DNA. These gene…

Q: For each of the following statements regarding protein import into mitochondria, indicate whether it…

A: Mitochondria are double-membraned bound organelles seen inside the cell. They are the site of energy…

Q: Consider a bacterial strain that has a mutant lac repressor that cannot bind the operator. A. What…

A: Operon is a group/cluster of genes in prokaryotes that codes for functionally related proteins.…

Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: VHL ceases to induce the degradation of HIF-1α under which of the following conditions?      A.…

A: VHL It is a protein that is involves in cellular functions, which includes the regulation of other…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.