The map below was constructed using information from an interrupted mating experiment. Str# refers to the strain numnber from which the data were obtained. The strains that are referenced by the Str#'s on the map are considered to be F+ strains. The units for the map distance values on this map are minutes Assume that four genes were transferred by each strain in the interrupted mating experiment. Based on this map, list in order of transfer (first to last) the genes transferred by Str4. Type your answer by typing in the letters that represent the genes without any spaces so that Moodle can grade it correctly. K Str2 10 9 Strl W Str5 8. R Str6 Str3 11 A Str4 12 6.

The map below was constructed using information from an interrupted mating experiment. Str# refers to the strain numnber from which the data were obtained. The strains that are referenced by the Str#'s on the map are considered to be F+ strains. The units for the map distance values on this map are minutes Assume that four genes were transferred by each strain in the interrupted mating experiment. Based on this map, list in order of transfer (first to last) the genes transferred by Str4. Type your answer by typing in the letters that represent the genes without any spaces so that Moodle can grade it correctly. K Str2 10 9 Strl W Str5 8. R Str6 Str3 11 A Str4 12 6.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

The following chromatogram is obtained from the sequencing reaction. Using the key below, what message did you integrate into the yeast genome? AATATTAAAGTATAGAACGACTGTGAA A B с D E F G H I AAA AAT AAG AAC ATT ATG ATC AGT AGG J K L M N O P Q R Key GGG GGA GGT GGC GAA GAC GAT GTT GTA S T U V W X Y Z (SPACE) TTT TTC TTA TTG TGT TGA TGG TAA TAG
We isolate DNA from a bacteria that is wild type for the genes arg leu and his shear it in a blender mix it into a culture of bacteria that is mutant for the genes arg leu and his . We then plate on various media. These are the results: Media with arginine 20 colonies /ml Media with histidine 300 colonies /ml Media with leucine 500 colonies /ml Media with all three 10000 colonies/ml 21. What is this experiment called? A. transpiration B. conjugation C. transformation D. transduction
Based on the attached image, if we are using the Holliday junction model of recombination, where exactly would be the positions where DNA is cut? Would it be to the right because of branch migration?
Answer part C of the following: A) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp fragments and put it through density gradient equilibrium centrifugation, you will find that all the DNA bands at the same place in the gradient, and if you graph the distribution of DNA fragments in the gradient you will get a single peak (see below). If you perform the same experiment with binturong DNA, you will find that a small fraction of the DNA fragments band separately in the gradient (at a different density) and give rise to a small "satellite" peak on a graph of the distribution of DNA fragments in the gradient (see below). Why do these two DNA samples give different results, when they're both 50% G-C? See graph B. B) If you denatured the random 1000 bp fragments of binturong DNA that you produced in question 1a by heating them to 95ºC, and then cooled them down to 60ºC and allowed them to reanneal, you would find that approximately 15% of the…
a) Sam wants to alter his interrupted mating experiment by placing a filter in between the donor and the recipient cells in order to separate the two. Is Sam’s suggestion for this modification to the procedure utilized in interrupted mating experiments valid? Explain. b) Much to the dismay of the researcher with whom Sam is working, Sam is not only forgetful, but he is also lazy! Rather than devoting the necessary hours to conducting his assigned interrupted mating experiments, Sam has decided that his time would be better spent modifying the F plasmid so that the experiments wouldn’t require quite so much time. The diagram below shows a map of the E. coli F plasmid, similar to that shown in lecture. Sam is determined to “get rid of some of the excess DNA” present in the plasmid. Please keep in mind that the PI in the lab in which Sam works utilizes these F plasmids for interrupted mating experiments between Hfr and F- cells as well as for interrupted mating experiments involving F+…
The genomes of two E. coli strains are compared in Figure14-19. Would you expect any third strain to contain moreof the blue, tan, or red regions shown in Figure 14-19?Explain.
The E. coli genome has a superhelical density in vivo of about 0.06. Assuming the DNA has 10.5 bp/turn, what is the expected writhing number of the E. coli genome?
Genomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)
From an Escherichia coli strain, five Hfr strains were isolated. The location and orientation of the transfer origin of each Hfr strain is shown in Figure 1. You want to use these five strains to map the locus responsible for thiamine synthesis, called thi. Each Hfr strain is sensitive to rifampicin (Rifs) and thi*. Conjugation experiments are performed between each of the Hfr strains and an F strain Rif Thi™. 0 T leu 10 20 T nadD pyrC trp 40 T his 60 70 2) The results are shown in the following table: Donor strain Hfr1 Hfr2 Hfr3 Hfr4 Hfr5 cysG 80 90 1) What is the selection medium used in these conjugation experiments metA Colonies Thi+ 1000 0 400 0 25 100 Hfr1 Hfr2 Figure 1: Chromosome map of Escherichia coli. Five Hfr strains (Hfr1 to Hfr5) were isolated and the location and orientation of the origin of transfer is shown by the arrows in each Hfr strain. Distances in minutes are shown. Leu: leucine biosynthesis; nadD: NAD biosynthesis; pyrC: pyrimidine biosynthesis; trp: tryptophan…
An Hfr strain that is leuA+ and thiL+ was mixed with a strain thatis leuA− and thiL−. In the data points shown in the following graph,the conjugation was interrupted at different time points, and thepercentage of recombinants for each gene was determined bystreaking on a medium that lacked either leucine or thiamine.Make a calculation.