The following diagram describes the mRNA sequenceof part of the A gene and the beginning of the B geneof phage ϕX174. In this phage, some genes are read inoverlapping reading frames. For example, the code forthe A gene is used for part of the B gene, but the readingframe is displaced by one base. Shown here is the singlemRNA with the codons for proteins A and B indicated.aa# 5 6 7 8 9 10 11 12 13 14 15 16A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeumRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUGB MetGluGlnLeuThrLysAsnGlnAlaaa# 1 2 3 4 5 6 7 8 9Given the following amino acid (aa) changes, indicatethe base change that occurred in the mRNA and theconsequences for the other protein sequence.a. Asn at position 10 in protein A is changed to Tyr.b. Leu at position 12 in protein A is changed to Pro.c. Gln at position 8 in protein B is changed to Leu.d. The occurrence of overlapping reading frames isvery rare in nature. When it does occur, the extentof the overlap is not very long. Why do you thinkthis is the case?
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
The following diagram describes the mRNA sequence
of part of the A gene and the beginning of the B gene
of phage ϕX174. In this phage, some genes are read in
overlapping reading frames. For example, the code for
the A gene is used for part of the B gene, but the reading
frame is displaced by one base. Shown here is the single
mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate
the base change that occurred in the mRNA and the
consequences for the other protein sequence.
a. Asn at position 10 in protein A is changed to Tyr.
b. Leu at position 12 in protein A is changed to Pro.
c. Gln at position 8 in protein B is changed to Leu.
d. The occurrence of overlapping reading frames is
very rare in nature. When it does occur, the extent
of the overlap is not very long. Why do you think
this is the case?

Trending now
This is a popular solution!
Step by step
Solved in 2 steps









