Study the sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 A C T G G C G A T C G C TTCCT TCG G T C G C A C G T 1 2 3 4 5 A C A G C C ACT A C T A C T G C G G GAA C CG T T G C C G A T C G GA G C A C G C A T T T T C C G G A C G C G T A C G A << < < C G T A C G

Study the sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Species 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 A C T G G C G A T C G C TTCCT TCG G T C G C A C G T 1 2 3 4 5 A C A G C C ACT A C T A C T G C G G GAA C CG T T G C C G A T C G GA G C A C G C A T T T T C C G G A C G C G T A C G A << < < C G T A C G

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter24: Systematics And Phylogenetics: Revealing The Tree Of Life

Section: Chapter Questions

Problem 12TYK

See similar textbooks

Similar questions

Construct the data matrix From the DNA sequence data from the 5 taxa. (Hint: there are three variable nucleotide sites, which are the characters) Map all three characters onto both mypotheses using two Colors (same as in Activity 6). 3 position 111111 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 ATTGCGGCCTGTATG Taxon A Taxon B ATGGCGGGCTGTAAG Taxon C ATTGCGGGCTGTATG Taxon D ATTGCGGGCTGTAAG Taxon E ATGGCGGCCTGTATG 1 Determine the treelength of both hypotheses and fill in 3 the treelength and Justify Text minimum number of changes in the table on the lower right. Then compute the CI for both hypotheses and put a checkmark or X to indicate which one is the most parsimonious and which one is the most accurate. 4 Character/ states Taxon A Use the most accurate phylogeny to infer the origin of the new fungal pathogen Taxon B Hypothesis Treelength Minimum CI Most parsimonious Most accurate Taxon C Taxon D 1 taxon taxon A taxon B taxon C taxon D taxon E Taxon E Minimum 2 origin Florida (new) Mexico China…
Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the relationship between the four species: M, L, S, and R. B A M LS R M LR +d \t R SML RM S tota -444 What is the plausible explanation for the appearance of autapomorphic character c in species L and S of tree A although they do not share a most recent common ancestor?
From the DNA sequence data for the eight species (A through H) shown below, what is the genetic distance between Species A and Species C? O 4 5 6 1 O 7 2 3 4 Species A ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAG ACT Species B ACCAGCCTGTGCATCGATGACGACTAAGTGATACCATAAAGACT Species C ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species D ACGAGCATGTGCATCGATGCCGACTAAGTGATACCATAATGACT Species ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT E Species Species F ACCAGCATGTGTATCGATGCCGACTAAGTGATACCAAAATGACT G ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT Species H ACCAGCATGTGTATCGATGCCGACTAAGTGCTACCATAATGACT 5 6 7
Based on the information from the following table and the provided phylogenetic tree, what kind of species classification is shown? A B C D E F G H 1 J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L r T Pits) or Tubercles E P P T T T T T P P P P P Р P P O Phenetic Species Concept O Blological Species Concept O Phylogenetic Species Concept O Sympatric Species Concept Blayple (OUTGROUP) beaver Dan, AZ -Twentynine Paime, CA -Harkavilla, UT D-Chilchinbio, NM -Vermilion Cas. AZ 64 -F-Mone Lake, CA -G-Coral Pink Danes, UT H-Pyramid Lake, N -Crescent Dunes, MV Meno Lake CA -K-Olancha CA -Olancha, CA --Winnemucca, NV -El Mirage, CA Lo-Dumont Dunes, CA Form of dorsal ridges M₁ M₁ FFFFFFFFFF M Ma M₂ M₂
Part 3: Molecular Evolution Exercise Below are reported nucleotide species of animals. sequences for an intron in the same gene for 4 different A В D G T T A A G. A A A A T T G G CGTGG < ETCATOGAGGATO CCTTG < ATTCA CCTGG <
Study the amino acid sequences below. Construct a molecular cladogram from the different amino acid sequences given. Assume that the sequences are already compared between species and have been aligned as shown. Organism Amino Acid Sequence Amoeba ISO SER ASP GLN PHE ILE LEU GLN SER ARG LEU LEU HIS Kangaroo LEU ISO PRO PRO PHE ILE LEU LEU SER HIS LEU LEU SER Earthworm LEU ISO ASP PRO PHE ILE LEU HIS SER ARG LEU LEU ARG Cat LEU ISO PRO PRO PHE ILE LEU LEU SER HIS LEU LEU SER Shark LEU ISO PRO PRO PHE ILE LEU LEU SER ARG LEU LEU ARG Dolphin LEU ISO PRO PRO PHE ILE LEU LEU SER HIS VAL VAL SER Lizard LEU ISO PRO PRO PHE ILE LEU LEU SER ARG LEU LEU ARG
Asap
The table shows the number of cytochrome c amino acid differences as compared to human cytochrome c. (see 2-point scoring rubric) Monkey Rabbit Shark Tuna Turtle Number of amino acid differences compared to human cytochrome c Frog 9 Horse 5 1 4 14 11 8 4. Suppose that two species, A and B, appear similarly but have molecular homoplasy, while species B and C appear differently but have molecular homology. Which pair of species is more likely to be closely related? Explain.
Study the diagrams below. The diagrams represent four possible phylogenetic trees showing the relationship between the four species: M, L, S, and R. B A M LS R S M LR fd \t a Which of the phylogenetic trees is the most parsimonious? a. Tree B b. Tree D c. Tree C R S M L St RM S
A researcher studying two species (species 1 and species 2) sequences a short stretch of eight codons from the same gene, gene B, in each and compares them. Species 1 and species 2 had a most recent common ancestor 50 million years ago. Species 1: ATC GGG CGG GAC TTA CTA TAT GCC Species 2: ATT GGG CGG GAC TTG CTA TAT GCC Given the differences between the sequences of the two species' genes shown here, what evolutionary force can you predict is most likely in operation on gene B?
A team of scientists has determined the gene sequence of a newly discovered species of insect to be: 5'- ATG GGT GAT GTT GAA AAA-3'. The table shows the gene sequences of four other species of insects. Gene Sequence Species newly discovered species 1 2 5'-ATG GGT GAT GTT GAA AAA-3' 5'-ATC GGT GAT GTT GAA ATA-3' 5'-ATG GGT GAA GTT GTT AAA-3' 5'-ATG GGT GAA GTT GAA AAA-3' 5'-ATG GGC GAT GTT GAA TTT-3' 3 4 Using the biochemical similarities, what can be generalized about the evolutionary relatedness of the newly discovered species? The newly discovered species is most closely related to species 3. The newly discovered species is equally related to all four species of insects. The newly discovered species is most closely related to species 4. The newly discovered species is not related to any of the four species of insects.
es ne Based on the information in the following table, and the given phylogenetic tree, what kind of species classification is shown? A B C D E F G H I J K L M N O Form of Male Genitalia 1 1 L L L L L L L L L L L L L Pits (P) or Tubercles (T) P P T T T T T P P P P P P P P Form of dorsal ridges M₁ M₁ M₂ M₂ M₂ M₂ M₂ M3 M3 M3 M3 M3 M4 M3 M3