REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens Substrates needed in the synthesis process An enzyme responsible for the elongation of the polymer Signal for the enzyme to start synthesis Signal for the enzyme to stop synthesis Direction of synthesis

REPLICATION TRANSCRIPTION TRANSLATION The specific location in the cell where the process happens Substrates needed in the synthesis process An enzyme responsible for the elongation of the polymer Signal for the enzyme to start synthesis Signal for the enzyme to stop synthesis Direction of synthesis

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 38CTQ: Contrast transcription and translation. Name at least three differences between the two processes.

See similar textbooks

Similar questions

DNA replication ATGGATCAGHTCCAGGGTACCCA what would the new strand look like
When DNA is replicated, two new DNA double helices areformed, each consisting of one parental strand and onenew, daughter strand. For this reason, DNA replication iscalled________ .
During DNA replication, 3 different proteins are used in the process to unwind and seperate the DNA. What are these 3 proteins and is there an helpful way that can I remember what each of thier functions are?
Semiconservative replication, the enzymesthat carry it out, and why it results in twoDNA molecules that each contain one oldand one new nucleotide polymer
he bases of one of the strands of DNA in a regionwhere DNA replication begins are shown at the endof this problem. What is the sequence of the primerthat is synthesized complementary to the bases inbold? (Indicate the 5′ and 3′ ends of the sequence.)5′ AGGCCTCGAATTCGTATAGCTTTCAGAAA 3′
List the differences and similarities in the way the twodaughter strands of DNA are synthesized at a replicationfork.
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
DNA Replication For the following piece of DNA, draw the replicated piece of DNA show me where the original and replicated strands of DNA end up. A ATCCGTTACCCA A ACGATATC C GTTA AC C GC G ITAG GCA ATGG GTTTG CTATAG GCA ATTGG C G C
smolA eno DNA -- THE DOUBLE HELIX (modified from The Biology Corner - Worksheets and Lessons) The nucleus is a small spherical, dense body in a cell. It is called the "control center" because it controls all the activities of the cell. Chromosomes, found in the nucleus, are microscopic, threadlike strands composed of the chemical DNA (short for deoxyribonucleic acid). Chromosomes are composed of genes, which is a segment of DNA that codes for a particular protein which in turn codes for a trait. It is commonly referred to as the gene for baldness or the gene for blue eyes. In 1953, James Watson and Francis Crick established the structure of DNA. The shape of DNA is a double helix, which is like a twisted ladder. The sides of the ladder are made of alternating sugar and phosphate molecules. The sugar is deoxyribose. Color all the phosphates red (labeled with a "p"). Color all the deoxyriboses blue (labeled with a "D"). The rungs of the ladder are pairs of 4 types of nitrogen bases. The…
I having a hard time understanding this since the both template strand in the end is the same the G in 5' -3' and G 3'-5' is it possible to replicate it? Can you explain it? Thank you so much.
Replication _______________ form as the replication forks spread our in opposite directions.
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.