Refer to the sequence below to answer the following questions. 5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’ 3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’ Is the sequence from a bacterial or a eukaryotic cell?Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?
Bacterial Genomics
The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.
Transformation Experiment in Bacteria
In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.
Plasmids and Vectors
The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.
Refer to the sequence below to answer the following questions.
5’- CACTTTTCAACTTGGCAGAAGCAATGTATCTCCGGATATAATCGCTTTCGAATTCG- 3’
3’- GTGAAAAGTTGAACCGTCTTCGTTACATAGAGGCCTATATTAGCGAAACTTAAGC- 5’
Is the sequence from a bacterial or a eukaryotic cell?
Identify the characteristics that support the rationale for your decision. Which DNA strand serves as the template for transcription?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps