A portion of the coding sequence of a cloned gene is shown here:5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄This portion of the gene encodes a polypeptide with the aminoacid sequence alanine–proline–aspartic acid–leucine–histidine–histidine–tyrosine–glycine–aspartic acid. Using the method ofsite- directed mutagenesis, a researcher wants to change the leucinecodon into an arginine codon, using an oligonucleotide that is19 nucleotides long. What is the sequence of the oligonucleotidethat should be used? Designate the 5′ and 3′ ends of the oligonucleotidein your answer. Note: The mismatch should be in the middleof the oligonucleotide, and a 1-base mismatch is preferableover a 2- or 3-base mismatch. Use the bottom strand as the templatestrand for this site-directed mutagenesis experiment.
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
A portion of the coding sequence of a cloned gene is shown here:
5΄–GCCCCCGATCTACATCATTACGGCGAT–3΄
3΄–CGGGGGCTAGATGTAGTAATGCCGCTA–5΄
This portion of the gene encodes a polypeptide with the amino
acid sequence alanine–proline–aspartic acid–leucine–histidine–
histidine–tyrosine–glycine–aspartic acid. Using the method of
site- directed mutagenesis, a researcher wants to change the leucine
codon into an arginine codon, using an oligonucleotide that is
19
that should be used? Designate the 5′ and 3′ ends of the oligonucleotide
in your answer. Note: The mismatch should be in the middle
of the oligonucleotide, and a 1-base mismatch is preferable
over a 2- or 3-base mismatch. Use the bottom strand as the template
strand for this site-directed mutagenesis experiment.

Trending now
This is a popular solution!
Step by step
Solved in 4 steps









