Predict the amino acid sequence produced during translation by the following short hypothetical mRNA sequences (note that the second sequence was formed from the first by a deletion of only one nucleotide): Sequence 1: 5'-AUGCCGGAUUAUAGUUGA-3'Sequence 2: 5'-AUGCCGGAUUAAGUUGA-3'What type of mutation gave rise to sequence 2?

Q: Examine the following mRNA transcripts: Wild type: 5' CACUGAUGCACGGAUCAU 3' Mutant: 5'…

A:

Q: 5'-ATGGAATTGGCATGGTTTACCCGTGATGGT-3' 3-ТАССТТААСCGTACCAAATGGGCACTACСА-5' 1. Determine the sequence…

A: Since we answer the first question in case of multiple questions. If you want any specific question…

Q: What is an Okazaki fragment, and how are they later “glued” together?

A: In the semi discontinuous mode of replication when DNA unwinds , one strand is synthesized…

Q: Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the…

A: Protein consists of amino acids.

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: Calculate the expected number of times that a given 8-base-pair DNA site should be present in the E.…

A: A bacterial genomic DNA resides inside cells in a highly condensed and functionally organized form…

Q: The antibiotic paromomycin binds to a ribosome and induces the same conformational changes in 16S…

A: Ribosomes are complex molecules that are composed of ribosomal RNA molecules where photosynthesis…

Q: About 98% of the E. coli genome codes for proteins, yet mRNA, the template for protein synthesis,…

A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: What polypeptides would be formed from the sequence UCAATGGGGUUUAUAGCG… (there are bases after the…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr--- O Met-Ala-Ala-Thr-Tyr---- O…

A: Aminoacyl tRNA synthetase are enzymes of extreme importance during the process of protein synthesis…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: Human wildtype and mutant alleles are identical in sequence except for a single base-pair…

A: A mutation is any change in the DNA sequence of a cell. It may alter one or a few base pairs or…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…

A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: Eukaryotes modify mRNA with an m7G cap: an  N7-methylated guanosine linked via a 5′ to 5′…

A: Post transcriptional capping refers to the attachment of an enzymatically appended cap on the 5'…

Q: A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a…

A: Amino acids are coded by a tripeptide sequence called codons. The first two positions of the codon…

Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…

A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…

Q: A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein…

A: DNA is the genetic material in humans. It carries information that is transferred from one…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: hat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’?…

A: introduction

Q: When the cDNA was sequenced by the Sanger method utilizing ddCTP, the following products were…

A: Answer :: If the dCTP was not present, the polymerization would come to a standstill, resulting…

Q: What is the order of the polypeptide chain shown in the images provided?    Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: Eukaryotes modify mRNA with an m7G cap: an  N7-methylated guanosine linked via a 5′ to 5′…

A: Post transcriptional modification in Eukaryotic mRNA occurs by its enzymatic caping. The capping of…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.