Post-synaptic receptors located on the membrane of skeletal muscle cells allowthe muscle cells/fibers to respond to the neural-stimulus. What is the name of thereceptors located on the post-synaptic membrane of the muscle cells (you can’t findthe answer in the textbook; you have to do some research)?A. beta receptorsB. alpha receptorsC. muscarinic receptorsD. nicotinic receptors
Q: Which is true? All chordats are vertebrates, non chordates have a vertebral column, all vertebrates…
A: Before we can answer the question, we need to understand the terms involved. Chordates are a broad…
Q: Which common feature is common to amphioxus, frog , sea horse and crocodile? Skeleton cartilage and…
A: First, let's identify the common features among the given organisms: amphioxus, frog, sea horse, and…
Q: Question 5 (Mandatory) (2 points) ✓ Saved Why is prey productivity always more than predator…
A: The correct answer is C) Because energy is lost at each trophic level due to basic maintenance costs…
Q: questions and answers about this topics
A: Approach to solving the question:Here are the main topics typically covered under General…
Q: QUESTION 4 In an effort to have a successful tissue transplant, the a. IgD antibodies Ob. IgG…
A: In a tissue transplant, the immune system plays a crucial role in determining the success of the…
Q: Educake-Online Formative Ass X + e.co.uk my educake/quiz/144383766 Key Stage 3 Science - Biology…
A: Here's a detailed explanation of the liver, kidney, and bladder: A. LiverThe liver is a large, vital…
Q: What are the steps to identify genes in geotaxis of Drosophila melanogaster?
A: Geotaxis is the movement of an organism in response to gravity. In the case of Drosophila…
Q: Below are the results of different Plant pigments extracted through paper chromatography. What does…
A: Paper chromatography is a technique used to separate mixtures and identify compounds. It is used in…
Q: Overview of Transformation Protocol -Prepare competent bacteria for transformation: Treat starter…
A: Here is the sketch diagram of the Rainbow Transformation demo, depicting the results for all four…
Q: Biology Question - Question 4 Question is showed in attached picture
A: The ABO blood type system is determined by the ABO gene, which has three alleles: I^A, I^B, and i.…
Q: Below is another image of dividing onion root cells undergoing mitosis. In what phase of mitosis is…
A: Mitosis is the process by which a eukaryotic cell divides its nucleus and separates its chromosomes…
Q: Are these muscles agonist pairs, antagonist pairs, or synergists? Flexion:Extension: 2. Name a…
A: 1. Flexion involves decreasing the angle between two body parts, bringing them closer together. For…
Q: What kinds of environmental conditions do you think might make having an iteroparous life history…
A: Before we delve into the environmental conditions that might make having an iteroparous or…
Q: While the SA node is considered the pacemaker of the heart, the AV node is also capable of…
A: I have provided you the template and example and all the context where you can extract and improvise…
Q: Literature review investigating the positive impact of water conservation on sandals Resort open
A: Water conservation refers to the reduction in water usage and the protection of water from…
Q: Prior to giving an injection of anything (vaccine, medication, etc.) why is it important to eject a…
A: "Priming" the syringe is the process of ejecting a few drops of the substance from it prior to…
Q: Write one question for each topic listed. Topic: Connective tissue proper or epithelial tissue…
A: Let's justify each of the question we formulated for each topic: 1. Connective tissue proper or…
Q: Describe at least four cancer diagnoses that have been linked to the work environment,
A: Lung Cancer: This is one of the most common types of cancer linked to the work environment. It is…
Q: One effective way to learn new information is to create an R-E-C table. A R-E-C table allows you to…
A: The statement that some tissue types give rise to human cancers more often than others reinforces my…
Q: Explain why homologies are used in constructing phylogenetic trees (2 pts). Give two specific…
A: Two Specific Examples of How Using Analogous Characters Would Result in an Incorrect Phylogenetic…
Q: what is the equation for calculating mu in genetics? Like determining map distance in recombination…
A: In genetics, the map distance between two genes is a measure of the frequency of recombination…
Q: Give me detailed Solution. Don't give Ai generated solution
A: Transcription is a process where the DNA sequence is used as a template to synthesize a…
Q: Thoroughly explain how the splicesome works.
A: The spliceosome is a large and complex molecular machine found primarily within the nucleus of…
Q: To the right of each reaction, write the name or the structure of the coenzyme required for…
A: 1. Reaction (a): Carboxylation of Acetyl-CoA to Malonyl-CoAReaction Description: In this reaction,…
Q: The Beadle and Tatum experiment, conducted in the 1940s, was groundbreaking in molecular biology,…
A: The Beadle and Tatum experiment was a significant milestone in molecular biology. The experiment was…
Q: Create a Punnett Square representing the cross between the brown and albino mouse for each of the…
A: In this scenario, we are dealing with two traits: brown and albino. Let's assume that brown is the…
Q: explain how ecoli can cause people to get sick
A: References:https://www.cdc.gov/mmwr/preview/mmwrhtml/00019541.htmhttps://pmc.ncbi.nlm.nih.gov/articl…
Q: Please draw them and folllow direction A) describe what you see, and (b) give examples of locations…
A: A) picture of each epithelial tissue:1) Simple squamous epithelium:2) Simple cuboidal epithelium:3)…
Q: Fiyona Biomagnification Through a Food Chain Purpose: You will use M&M candies to model…
A: Explanation:This simulation demonstrates the process of bioaccumulation and biomagnification. At the…
Q: In another question, you explained the classical monocot leaf pattern. However, in this life…
A: The plants Poa pratensis (Kentucky bluegrass) and Zea mays (maize) are both monocots, meaning they…
Q: What is cardiac output? How do you anticipate increased heart rate to impact stroke volume? Briefly…
A: Detailed explanation:Cardiac Output and the Impact of Heart Rate on Stroke VolumeCardiac Output (CO)…
Q: Relative to a skeletal muscle contraction, a protein called __________________keeps the contractile…
A: The question is asking about a specific protein that prevents the interaction and formation of…
Q: Hello, Can you please help me to learn more about the influenza? What is influenza? What causes…
A: 1. What is Influenza?Influenza, commonly known as the flu, is a contagious viral infection that…
Q: The adaptive value is a measure of the evolutionary impacts of a behaviour, i.e. the ultimate…
A: The behaviour of a horse gently swishing its tail and occasionally stomping its feet is a response…
Q: What is the difference in effect of alpha 1 adrenergic receptors and beta 2 adrenergic receptors on…
A: Question #1:Here's a simple table to summarize the comparison between alpha-1 and beta-2 adrenergic…
Q: Need help with the 2nd part on the bottom half of the page
A:
Q: Using the envelope depiction we presented in class, draw out chemical structures for thefollowing…
A:
Q: Answer in step by step with explanation. Don't use Ai and chatgpt
A: To answer the question presented in the image, we need to calculate the average CFU/mL…
Q: a) How does the Cas-9/RNA sequence target a piece of DNA for destruction? b) Why does DNA travel…
A: The Cas-9/RNA sequence targets a piece of DNA for destruction through a process known as CRISPR…
Q: Summarize this article. What is the thesis of this article? Farias PM, Marcelino G, Santana LF, de…
A: Expanded Summary of the Article.The article by Farias et al. (2020) (titled Minerals in Pregnancy…
Q: Q3. Placing blood cells into a solution that is hypertonic to the cells will cause the osmotic…
A: Step 1:Osmotic pressure is the pressure to prevent the flow of water across a semipermeable membrane…
Q: 5' CCTAGCTTTCCGATAAAGCTATTCAAGT 3' The Alu1 enzyme cuts at this sequence: 5' AGCT 3' sequence. How…
A: To determine how many DNA fragments result from cutting the given DNA sequence with the AluI enzyme,…
Q: Realted to the experiment of the unknown organic substances which are citric acid, acetone, urea,…
A: c) Then the next step in the flow chart was the pH. What were you expecting to identify or separate…
Q: = Menu #2 Mol Bio Mutation QUESTION... # 3 Mol Bio Gene of inter.. X + Create All tools Edit Convert…
A: Solution:Task 1: DNA ExtractionA. Using sodium dodecyl sulfate, a detergent:• Answer: Sodium dodecyl…
Q: There has been considerable concern about finding good ways to treat infections involving biofilms,…
A: First, let's describe a biofilm. A biofilm is a community of microorganisms living together in a…
Q: Don't upload image. Answer in step by step with explanation. Don't use Ai and chatgpt
A: Step 1. Relative Water Level: 45 Explanation: At this level, the mouse population cannot sustain…
Q: a) Use the codon chart to translate the following mRNA codons into amino acids: AUG GUU AAC CAG UGA…
A: Key references:Campbell, N. A., & Reece, J. B. (2017). Biology (11th ed.). Pearson.OpenStax.…
Q: Match the following scenarios with the best term. You will probably need to look this stuff up in…
A: Here are the matches for the scenarios with the best corresponding terms: Often a result of…
Q: Please correct answer and don't use hand rating
A: In a spectrogram, speech sounds are represented visually with time on the x-axis, frequency on the…
Q: a)At what wavelength (nm) on a spectrometer can this color be quantified? b)…
A: a) At what wavelength (nm) on a spectrometer can this color be quantified?In most colorimetric…
the muscle cells/fibers to respond to the neural-stimulus. What is the name of the
receptors located on the post-synaptic membrane of the muscle cells (you can’t find
the answer in the textbook; you have to do some research)?
A. beta receptors
B. alpha receptors
C. muscarinic receptors
D. nicotinic receptors
Unlock instant AI solutions
Tap the button
to generate a solution
Click the button to generate
a solution
- Local anesthetics "block" the action potential and therefore do not allow "pain" information to proceed to the brain and spinal cord. In the presence of these molecules (local anesthetics) 'threshold' is essentially "ignored". The molecules most logically work by: 23. a. Decreasing the intracellular [potassium] b. Blocking the opening of the voltage-gated potassium channels c. Decreasing the extracellular [sodium] d. Blocking the opening of the voltage-gated sodium channelsIn the stretch reflex,a. Golgi tendon organs activate contraction in extrafusal muscle fibersconnected to that tendon.b. lengthening of muscle-spindle receptors in a muscle leads tocontraction in an antagonist muscle.c. action potentials from muscle-spindle receptors in a muscle formmonosynaptic excitatory synapses on motor neurons to extrafusal fiberswithin the same muscles.d. slackening of intrafusal fibers within a muscle activates gamma motorneurons that form excitatory synapses with extrafusal fibers within thatsame muscle.e. afferent neurons to the sensorimotor cortex stimulate the agonist muscle to contract and the antagonist muscle to be inhibitedWhich of the following produces EPSP? A. GABA acting on GABAA receptors OB. GABA acting on GABAC receptors C. GABA acting on NMDA receptors D. Glutamate acting on AMPA receptors OE. Kainate acting on GABAB receptors
- T O b. Regulate the flow of somatosensory information to the brain O c. Enhance the antigravity reflexes of spinal cord and help in standing posture O d. Liberate the antigravity muscles from the reflex control of the spinal cord QUESTION 14 What is the function of the presynaptic "autoreceptors" in axon terminals? a. To release substances into the blood Ob. To detect transmitter concentrations in the cleft Oc. To release neurotransmitters into extracellular fluid Od. To release the neurotransmitter acetylcholine esc QUESTION 15 What distinguishes the ANS from the somatic motor system? a. The ANS excites its peripheral targets. Ob. The ANS balances synaptic excitation and inhibition. c. The ANS has a single function. Od. The ANS constitutes total neural output. Click Save and Submit to save and submit. Click Save All Answers to save all answers. Type here to search f1 7 ? f2 C f3 # 3 A O +&+ 4 10 f5 % LO 5 f6 D 10 A 6 f7 & 7In the disease myasthenia gravis, the human body makes—by mistake— antibodies to its own acetylcholine receptor molecules. These antibodies bind to and inactivate acetylcholine receptors on the plasma membrane of muscle cells. The disease leads to a devastating progressive weakening of the people affected. early on, they may have difficulty opening their eyelids, for example, and, in an animal model of the disease, rabbits have difficulty holding their ears up. As the disease progresses, most muscles weaken, and people with myasthenia gravis have difficulty speaking and swallowing. eventually, impaired breathing can cause death. explain which step of muscle function is affected.At a normal NMJ, action potentials in the skeletal muscle cell can be blocked directly by? A. Curare, which inhibits nicotinic receptors. B. Atropine, which inhibits muscarinic receptors. C. Physostigmine, which inhibits ACHE. D. AP5, which inhibits NMDA receptors. E. Pentobarbital, which enhances the function of GABA on GABAA receptors.
- Students in a veterinary school are given the following hypotheticalproblem: A dog ingests organophosphate poison, and the students areresponsible for saving the animal’s life. Organophosphate poisons bindto and inhibit acetylcholinesterase. Several substances the studentscould inject include the following: acetylcholine, curare (which blocksacetylcholine receptors), and potassium chloride. If you were a studentin the class, what would you advise to save the animal?Which of the following produces IPSP? A. GABA acting on GABAA receptors B. Glutamate acting on AMPA receptors C. Glutamate acting on kainate receptors D. Glutamate acting on NMDA receptors E. Acetylcholine acting on nicotinic receptorsWhich structure transmits impulses towards the nerve cell body? Select one: a. Dendrite b. Axon C. None is correct d. Axon hillock e. Synaptic knobs
- Sarin nerve gas paralyzes muscle by interfering with neuronal transmission by which of the following? Select one: O A. encephalin O B. serotonin O C. acetylcholine O D. glutamate O E. GABANicotinic receptors are located on which of the following? a. plasma membranes of ganglionic neurons b. target cells that receive parasympathetic innervation c. blood vessels in skeletal muscles d. sweat glandsWhich structure transmits impulses towards the nerve cell body? Select one: O a. Dendrite b. Axon None is correct O d. Axon hillock e. Synaptic knobs