Answered: Name the first complementary base from…

Name the first complementary base from the 5' direction. 2.Give the ABBREVIATED NAME of the nucleotide in the 5' end. 3. Name the second complementary base from the 5' direction.

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: The following represents a DNA strand in the process of replication. The bottom sequence is that of…

A: DNA replication is the process in which a copy of already existing genome is formed. A pair with T…

Q: 16) In a DNA molecule, the phosphate group is attached to the 5' end of a nucleotide True or false…

A: The answer is true .…

Q: 2. The passage says that "the four unique bases are like the letters in a word". What does this…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Illustrate a short DNA segment showing the bonds formed between complementary base pairs as well…

A: Introduction: The two types of nucleic acids are RNA and DNA. The nucleic acid serves as a…

Q: The DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the…

A: chargaff's rule states that in DNA sequence in complementary strands the Adenine will form a bond…

Q: You will start off by laying out your individual nucleotides for the first strand using the…

A: DNA is a macro molecule or a polymer which is made up of a monomer called nucleotides. Each…

Q: Two base pairs of double-stranded DNA are shown in the figure. Use your knowledge of base structure,…

A: DNA In DNA there are 4 bases Adenine, Thymine, guanine and cytosine. Adenine binds with Thymine…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: One DNA strand has the sequence 5' -ATTCCGTAGC-3' what is the complementary strand sequence?

A: DNA ( Deoxyribonucleic acid ) is two stranded structure which act as genetic material in most of the…

Q: 1. What is the difference between a nucleotide and a nucleoside? Explain by giving an example, using…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Fill in the banks for the relative percentage of bases in a DNA T C G A 13 Strand 1 12 Strand 2 The…

A: The bond that is present in between sugar and nitrogen bases is glycosidic bond. The bond that is…

Q: Consider a portion of double-stranded DNA with the complementary sequence of base pairs shown. Write…

A: DNA is genetic material in most of living organisms. There are four nitrogenous bases present in…

Q: ATCGGCTAGCTACGGCTATTTACGGCATAT The above string of nucleotides represent a DNA leading strand of…

A: DNA is a double helical structure composed of two DNA strands.

Q: Why are nucleobases in nucleic acids called "bases"? 1. Because they resemble baseball bases…

A: Nucleobases : Purine(A,G), pyrimidine(T,C) Purines hydrogen bonds with pyrimidines A double bond T G…

Q: 1. Name the bonds that help to hold the two DNA strands together. 2. Name the three-dimensional…

A: 1) Hydrogen bonding 2) Double helix 3) 12 4) Complementary

Q: Complete the table to determine the amounts of other nucleotides found in each DNA sample.

A: DNA Sequencing A laboratory process used to learn the exact sequence (order) of the four building…

Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…

A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh

Q: A) Draw the structure and give the name of a nucleotide made of G + ribose. B) Write the…

A: Ribonucleic acid (RNA) is a polymer of ribonucleotides that participate in diverse biological roles…

Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-TTAGGAG-3'

A: DNA strands are boned together with the help of hydrogen bonds present between the base pairs. These…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-CACGGGG-3'

A: Deoxyribonucleic acid (DNA) is a double stranded polynucleotide coiled around a central axis to form…

Q: 1. On paper, write out the first 30 bases in the middle of the page in order. You want ensure you…

A: Disclaimer: "According to the guidelines of bartleby, only one question is to be answered. Please…

Q: The nucleotides are very specific as to which bond together. The four nucleotides are:Adenine (A)…

A: DNA nucleotides are adenine (A), thymine (T), guanine (G) and cytosine (C). These nucleotides come…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand?…

A: As per the general rule, the base adenine (A) always pairs with thymine (T) and the guanine (G)…

Q: ou turn up the heat to 95° Which is the most likely outcome? Explain your answer. Both duplexes…

A: Polymerase chain reaction (PCR) is versatile in vitro method for amplifying the defined target DNA…

Q: What type of bond is the arrow pointing to in this image of DNA? -Hydrogen Bond -Covalent Bond…

A: DNA is a molecule that was discovered in the late 1860s by Friedrich Meischer in the nucleus but its…

Q: Write the base sequence and label the 3' and 5' ends of the complementary strand for a segment of…

A: DNA is a duplex helical molecule, which has complementary base pairs. The complementary strands are…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5 -TGTCCCA-3'…

A: Nucleic acids are the biomolecules composed of nucleotide units. A nucleotide unit is composed of a…

Q: How many hydrogen bonds exist between this DNA strand and its complementary strand? 5'-GCATAAT-3'

A: Nucleic acids are biomolecules that are essential for all life forms. They are polymers of…

Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…

Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…

A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…

A: Purines is equal to pyrimidines. So A=T C=G

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: A strand of DNA contains the base pair 5’-T-C-A-G-C-A-T-3’. Give the base sequence on the…

A: Answer

Q: DNA: 3. 2. 1: what is #1? 3: (name the sugar) 2: N bases used RNA: 3. 1: what is #1? 2. 3: (name the…

A: In the given question we have two figures One of the DNA and the other of RNA. DNA consists of a…

Q: complementary DNA sequence

A: Answer: Complementary sequence: Nucleic acid sequence of bases that can form a double- stranded…

Q: Fill in the missing bases below to show the correct complementary base pairing. 5' 3'

A: In molecular biology Complementary base pairing or complementarity is a relation between two…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: 2. 00

A: The DNA molecule is made up of two strands that coil around each other to form a double helix…

Q: a decision was made that the next step is nucleotide position 10. Why not choose position 3? In your…

A: The objective of the question is to understand why nucleotide position 10 was chosen over position 3…

Q: 8. Which of the following diagrams best illustrates a DNA molecule? R R R CH, O H H3C CH3 H CH, O ||…

A: Genetics is the branch of biology that deals with genetic material like DNA, RNA, inheritance.…

Q: During DNA replication, a template strand is used to synthesize a new "daughter" strand of DNA.…

A: During DNA replication, the double-stranded DNA molecule unwinds and separates into two individual…

Question

1. Name the first complementary base from the 5' direction.

2.Give the ABBREVIATED NAME of the nucleotide in the 5' end.

3. Name the second complementary base from the 5' direction.

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

1. Name the first complementary base from the 3' direction. 2. Name the fourth nucleotide from the 3' to 5' end. Use the correct/appropriate punctuations, spacing and letter case based on the nomenclature. 3. Name the second complementary base from the 3' direction.
Please help me to write the complementary strands of the following: 1. A strand of DNA has the base sequence ATGATC. Write the base sequence for the complementary strand. 2. A strand of DNA has the base sequence GATTCA. Write the base sequence for the complementary strand. Thank you very much for your help.
Which of the following does NOT describe DNA as it occurs in Eukaryotic cells. CHOOSE ALL THAT APPLY: 1. nitrogenous bases of opposite strands are paired through covalent bonds 2. base pairs are stacked 3.4 A (0.34 nm) apart 3. the two strands of one double helix are complementary 4. two long polynucleotide chains 5. there are 20 base pairs per each turn of a double helix 6. adenine pairs with thymine of the neighboring nucleotide in a single DNA strand 7. bases face outside of the double helix 8. consecutive nucleotides of a single DNA strand are linked by hydrogen bonds 9. here are A-T and G-C pairs in DNA double helix 10. sugar-phosphate backbone of a single DNA strand is formed by linking deoxyribose units and phosphate groups through phosphodiester bonds 11. the two strands of one helix are antiparallel 12.double helix 13. the larger major groove alternates with the smaller minor groove along the length of the double stranded DNA I tried 2,3,4,9,10,11,12,13 together and got it…
13. a. Draw in the corresponding DNA nucleotide that would base pair with the adenine nucleotide shown below using the same level of detail as provided in the image below. Hint: Remember that DNA bases pair in the antiparallel orientation. орасна you A OH H b. How do you know the adenine nucleotide drawn above is from DNA and not RNA?
Below are some nucleotide sequences located on a segment of one strand of DNA, from the 5'to the 3' Indicate the complementary sequence of nucleotides that would appear on the adjacent DNA strand from the 3' to the 5' end. 5' AGTCCG 3' 5' CCTTGA 3'
1) Translate a mRNA sequence into a protein sequence using the genetic code. 2) write the complementary base pairs for a single strand of DNA.
Match the correct bases pairs to find the opposite strand of DNA strand of DNA - T G C A A T G C C C G T A T A T G C C A complementary strand -
This figure shows a single nucleotide addition. What would happen if three nucleotides were added?
3. DNA polymerase made a mistake and added a C on the DNA template strand. In the space on the mRNA sequence below, write the added base. (Remember that the DNA template and mRNA are complementary. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5') CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3' On this mRNA codon table, the first nucleotide in codon is to the left, the second is above, and third is to the right. 4. A mutation in the gene encoding the aminoacyl tRNA synthetase for valine (VAL) causes the tRNA binding site to have the wrong shape. In its new (mutant) shape, the enzyme can bind tRNAs for VAL and leucine (LEU). (not at the same time but enzymes work fast and there are lots of them) a. In cells with this mutant tRNA synthetase, will the protein product of translation match the original one you deduced in question 2? circle one: (YES / NO. ) b. If not, how does it differ? c. How many different version of the short…
5. Shorthand DNA is written as antiparallel arrows with 5' and 3' ends. 3' a) What do the 5' and 3' ends signify? b) To which end are new nucleotides added when building a DNA strand?
3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase Reverse transcriptase RNA Polymerase Endonuclease 6. Sanger DNA sequencing relies on a method known as chain termination. Which molecule is used to terminate DNA chains to create molecules of all possible lengths covering the fragment to be sequenced? Deoxyribonucleotides Deoxyadenosine Deoxyguanosine Dideoxynucleotides
12. Draw the chemical structure of a dinucleotides (left: dCA with its complementary strand; right CA)