Q: How is the presence or absence of viable endospores related to sterility?
A: Endospore is a resistant asexual spore that develops inside the bacteria under the extreme condition...
Q: Would the following ancestral cell have been a prokaryote or an early eukaryote? Briefly explain you...
A: Biological evolution refers to the origin of first biological cell from non living chemical complexe...
Q: identify 4 key principles that govern animal behavior
A: The 4 key principles that govern animal behavior includes; Behaviour by instincts Learned behavio...
Q: ne parent nucleus. e two identical halves of a duplicated chromosome. sion of haploid (n) gametes; r...
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for...
Q: During protein synthesis, which of the following are involved in the steps that take place in the nu...
A: The central dogma of life is as follows DNA - RNA - Protein Thus to make protein we require RNA an...
Q: Which step of the gram stain procedure is most critical?why?
A: Gram staining is one of the most common laboratories test to identify the different bacterial specie...
Q: Agarose gel electrophoresis is a technique used to separate DNA fragments on an agarose matrix. The ...
A: INTRODUCTION Agarose gel electrophoresis This is a technique used to separate DNA based on their mol...
Q: Which of the following statements best describes the function of the cell membrane? O A) It controls...
A: Question - Which of the following statements best describes the function of the cell membrane? A) It...
Q: H. :0-H---:N-H H. H. Hydrogen Bond Which statement best helps explain the formation of the hydrogen ...
A: A hydrogen bond is a primarily electrostatic force of attraction between a hydrogen atom which is co...
Q: This legume, also called groundnuts, are originally native to South America. O Phaseolus vulgaris O ...
A: Plants are classified on the basis of presence or absence of root nodules . These plants are :- A )...
Q: What is the importance of knowing the following in crop production? Give a specific crop example. a....
A: A crop is a plant that is specifically cultivated and harvested for money (profit). Crop production ...
Q: what is the differrence between PM2.5 and PM10?
A: Particulate matter ( PM ) is suspended toxic matter in the air which lower down the quality of air a...
Q: Explain the term maternal inheritance? Which characters show this type of inheritance?
A: Genetics is the study of heredity in general and genes in particular. Genetic research is one of bio...
Q: The eukaryotic cell will spend most of its time in: _ interphase Why? Once the previous long process...
A: The eukaryotic cell will spend most of its life in interphase because in this phase the cell grows, ...
Q: Discuss the actions of the ditterent chemical agents in controlling microorganisms: L phenols 2. hal...
A: Chemical agents plays a major role in eradication of microorganisms from the environment.
Q: Explain how adherrence, capsules, cell wall components, and enzymes contribute to pathogenicity
A: We can answer only first 3 parts of the answer. So kindly repost " Explain how enzymes contribute to...
Q: What ethical issues may arise from the use of microscopes?
A: A microscope enables us to view microbial lifeforms that are not visible to the naked eye. The micro...
Q: A. iMAGE 1 1. What is a special characteristic of the microorganism shown? CHOICES: A.It shows col...
A: As per answering guidelines, we can answer only one question with a maximum of three subparts. So he...
Q: please answer allm,,,same choices
A: Carbohydrates are macronutrient, they contain carbon(C), hydrogen(H) and oxygen(O) atoms. Carbohydr...
Q: What is beta brain waves?
A: Brainwaves are the electrical impulses in the brain, our brainwaves can occur at various frequencies...
Q: After focusing the specimen in hpo, you switched the objectives halfway and dropped enough immersion...
A: A microscope enables us to view microbial lifeforms that are not visible to the naked eye. The micro...
Q: Oxygen is produced during the light reactions of photosynthesis. O True O False
A: The photosynthesis is the process by which green plants synthesise complex carbohydrate molecules fr...
Q: 38. Calculate the annual rate of natural increase (r) for a country with a birth rate of 29 per thou...
A: The rate of natural increase is given as a percentage, calculated by dividing the natural increase b...
Q: Which of the following forms of nitrogen is most commonly absorbed by plants? O nitrogen oxide O amm...
A: Nitrogen is one of the most important gaseous substance for all the living organisms and it is high...
Q: what happens when you change the objective lense
A: The compound light microscope is routinely used in cell biology laboratories to observe the internal...
Q: What is the function of the central vacuole? A) Increases the cell surface area and stores metabolic...
A: The large central vacuole is sorrounded by its own membrane and contains water and dissolved substan...
Q: Determine the number of bacterial cells per gram of meat. Please explain how you get to the answer
A: For the calculation of bacterial organism in a given sample we usually use serial dilution process a...
Q: Genetically modified foods are products produced from organisms that have had changes introduced int...
A: Genetically modified organisms food is obtained by the recombination technology where best gene of i...
Q: You and a friend are eating dinner together, and a number of events occur during your dinner that ca...
A: The first law of thermodynamics simply says the energy is conserved or the energy of the universe re...
Q: How do you think air can affect the vascular tissues
A: According to the question, we have to explain how the air can affect the vascular tissues. This ques...
Q: This part of glucose catabolism occurs in the cytoplasm in prokaryotes but in the mitoc eukaryotes, ...
A: The process through which a live creature oxidises glucose molecules and produces energy in the form...
Q: Term Prefix and meaning Suffix and meaning Combined Meaning 1. 2. 3.
A: zoology is the branch of biology. The study of animals is known as zoology (zoo-animal, logy-study)....
Q: 1. The cyanobacteria transformed Earth's atmosphere from anaerobic to aerobic conditions, during the...
A: Photosynthesis is a vital process in primary producers such as cyanobacteria and plants. Plants use ...
Q: After properly troubleshooting, you finally are able to visualize the gel. You obtained the image be...
A: INTRODUCTION Gel electrophoresis This is a technique that is used for the separation of DNA accordin...
Q: Roundup Ready soybean is genetically modified to resist insects. O True O False
A: Genetic modification is a technique in which genes are altered so as obtained desired characters in ...
Q: What are best nutritions for domestic animals to be bigger and healthier such as cats, dogs and chic...
A: Nutrition is very important for all of us without nutrition we can not do anything and we feel letha...
Q: In the process of transcription in eukaryotes, the RNA polymerase II transcribes 1. Precursor of mRN...
A: Introduction: Transcription is a process in which ribonucleic acid is synthesized from deoxyribonucl...
Q: Describe ,A Hfr bacterium mates with an F- plasmid containing bacterium. What
A: PLASMIDS- It was discovered that maleness in bacteria is determined by a transmissible genetic facto...
Q: Potatoes propagate asexually by which of the following? O rhizomes O bulbs O buds of tubers O stolon...
A: Vegetative reproduction is a form of asexual propagation that occurs in plants, in which the new pla...
Q: What steps could a team take to develop characteristics of a long-term sustainable food supply?
A: The first step to develop long term sustainable food supply is to use the available natural resource...
Q: Figure 1 above is showing the plasmid map of pUC18. Discuss how screening is carried out if this pla...
A: pUC18/19 is an artificial plasmid cloning vector. This plasmid vector comprises of Ampicillin [AmpR}...
Q: Example: From the biosphe Example: From the hydrosphi
A: The part could be a worldwide ecosystem created from living organisms (biota) and therefore the nonc...
Q: Which of the following have codons? amino acids acetyl transferase FRNA RNA polymerase proteins TRNA...
A: The DNA is the genetic material of the living organisms like humans. This molecule carries the info...
Q: List 10 tasks you would find in the opening and closing procedures of a kitchen? How would you compl...
A: Some kitchen safety rules are given below - Keep the kitchen clean and hygienic. Use mineral water...
Q: What structure is indicated by the number 2 in the image below?
A: Question - what structure indicated by number 2 ?
Q: Describe and explain the cellular locations and processes of Energetic Coupling (at least 2 types!) ...
A: Photosynthesis is a vital process for all plants in order to survive. Plants use the light energy an...
Q: Could cats or chickens or dogs gets bigger by food like feral does?
A: Its may not possible to increase the size of pets like cats, dogs and chicken. Feeding them with goo...
Q: During conjugation of an F strain of E. coli with an Hfr strain, it takes about 100 minutes to trans...
A: Bacterial conjugation is the process of transfer of genetic material between two cells by a bridge-...
Q: Part 2-Describe the Adaptations *Remember: An adaptation can be physical (a part of the animal's bod...
A: Lions have developed lungs and respiratory system. They breathe through nose and mouth. Other adapt...
Q: . iMAGE 1 1. What is a special characteristic of the microorganism shown? CHOICES: A.It shows colo...
A: Hi! Since you posted many questions, we will be answering the first for you. Please post the other q...
![Label the following parts of the DNA molecule
Phosphate, sugar, nitrogenous base
Nucleotide base pair , hydrogen bond
2.](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F8e2d0d99-d66b-4218-b744-75fd08ac90d3%2Fb52e349a-3e64-4b7a-b46e-9c0baca10cfb%2F4xp79h_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 2 steps with 1 images
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Draw a stylized diagram of double-stranded DNA. Use a pentagon for sugar, a circle for phosphate and a square for bases. Label each base A, T, C or G. Show two pairs of nucleotides connected via hydrogen bonds (use all 4 letters). Show the polarity of each strand and clearly indicate the number of hydrogen bonds in each pair of nucleotides. Draw a solid-line circle around a nucleotide. Draw a dashed-line circle around a nucleoside. Indicate a phosphodiester bond using an arrow.Match the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Complementary base pairs Double helix Antiparallel Nucleotide Hydrogen bonds Deoxyribose sugarOn the diagram of this DNA molecule, match the letters to the corresponding components: (should only be one for each) 5' carbon 3' carbon hydrogen bond phosphodiester bond phosphate group deoxyribose sugar nitrogenous base
- List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-GMatch the following terms with their correct definition. The structure of double-standed DNA Hold the base pairs together and make up the rungs of the DNA double helix One strand of nucleotides running in the opposite direction of the other strand Consists of a phosphate, a sugar backbone, and a nitrogen base A-T and C-G base pairs Five-carbon sugar found in DNA Answer Complementary base pairs Answer Double helix Answer Antiparallel Answer Nucleotide Answer Hydrogen bonds Answer Deoxyribose sugarDraw & label a simplified diagram of a DNA nucleotide:
- Draw the following segment of DNA molecule. [GTACA] Show the important covalent and non-covalent interactions as well as the complementary strand.In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’ ends, the bond that holds the DNA backbone together, the glycosyl bond, and the bond that holds the nitrogenous bases together. You can use “P” to represent phosphate, and ATCG to represent the nitrogenous bases. Please try to draw the sugar accurately and include any unbonded functional groups, including the oxygen within the molecule.
- Identify the key structural features of a DNA molecule. Strong ionic bonds and hydrophobic interaction hold DNA together. DNA bases are always paired purine with pyrimidine. DNA strands are antiparallel and include a 5' end and a 3' end. DNA contains the nucleotide bases adenine, thymine, guanine, cytosine, and uracil. DNA is most often found as a left-handed helix, commonly referred to as Z-DNA. The backbone of DNA is made of a sugar and a phosphate molecule.For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandShow the structure of a DNA where the lead strand is ATCG. Show H-, glycosidic, phosphoester bondings.
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)