Laboratory 5 – Rapid Purification of Plasmid DNANext, address why the examination of the restriction digestion on an agarose gelis a necessary step before proceeding with the ligation and transformation step.ntroduciodepessuccessfully make a new recombinant DNA molecule in the next lab exercises (Lab 6-8)? Why?Based on the answers you have given above, do you think you will be able to

Restriction Digestion is the process of cutting DNA molecules into smaller pieces with special…

Answered: Laboratory 5- Rapid Purificat Next,…

Laboratory 5- Rapid Purificat Next, address why the examination of the restriction digestion on an agarose gel is a necessary step before proceeding with the ligation and transformation step.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter18: Dna Technologies: Making And Using Genetically Altered Organisms, And Other Applications

Section18.1: Key Dna Technologies For Making Genetically Altered Organisms

Problem 2SB

See similar textbooks

Related questions

Q: Rationalize the use of all the reagents used in Agarose gel electrophoresis.

A: Agarose gel electrophoresis is a technique used to separate nucleic acids based on the size. The…

Q: Give a lab report introduction. introduction should include a general background on bacteriophages,…

A: A bacteriophage, also known as a phage, is a type of virus that infects and replicates within…

Q: Discuss about the reagents used for agarose gel electrophoresis

A: Gel electrophoresis is used to separate nucleic acid.

Q: Graph SEQ Graph ARABIC I p24 po/ml 10 3) Quantitative skills: Using the graph below, determine the…

A: This p24 capsid protein is expressed recombinantly at a large scale. The concentration of the p24…

Q: inical application: A 44-year-old man with HIV is receiving antibiotics through a intravenous…

A: HIV or human immunodeficiency virus is a virus causes AIDS in humans. HIV contains single stranded…

Q: Plaque assay (Bacteriophage Titer) Answer questions 2 & 3 2. Why don't bacteriophages continue…

A: Plaque assay is one of the widely used approaches for determining the quantity of infectious virus…

Q: The Effect of Closure Type on Preventing Microbial Contamination of Cosmetics Bacteria were isolated…

A: Shampoo, conditioner, serum, and oils are hair care products whereas lotions, moisturizers, etc.,…

Q: Hello sir, I khow it lakes preciouS Lab. Sheet-Level time, Please, I have a report on this Semester…

A: The measure of Cytotoxicity or cytotoxicity assays are required to measure or find out the ability…

Q: WHY IS IT NOT ADVISABLE TO MOVE/ TOUCH THE AGAROSE GEL IN THE PROCESS OF HARDENING.

A: The agarose gel is use as the ground substance for the growth of the various bacteria. Due to the…

Q: Define Bacteriocin, give a list of the different types of bacteriocins and the effects they have on…

A: Answer: Bacteria : These are the microscopic , single celled microorganisms that exists in…

Q: Discuss shortly five important things that should be kept in mind when designing a centrifugation…

A: Introduction: The method used for the detachment of an elements of an analyte dependent on contrasts…

Q: 1.why is it not advisable to move/touch the agarose gel in the process of hardening 2.what is the…

A: Gel electrophoresis is a method to separate the macromolecular such as DNA, RNA and protein and…

Q: Pipetting 1. Explain why a micropipettor is an important instrument in biochemistry labs. 2.…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: please provide at least one pathogen your method of analysis is used to detect.

A: Disrobe laboratory method Western blot proteins in an aqueous sample are separated by…

Q: Bacterial techniques, plasmid isolation, digestion and gel electrophoresis

A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…

Q: Description 1. The fractions obtained from differential centrifugation are enriched but not pure.…

A: Answer :- When dealing with complex biological samples, obtaining highly purified fractions is often…

Q: Sample of designer GMO and answer the ff questions 1. What is the name of your “designer GMO”? 2.…

A: GMO It means Genetically Modified Organism. These organisms have their genetic material manipulated…

Q: Discuss and explain the results of this graph. Graph shows results of WST-1 assay. T0 ( time zero)…

A: These are the type of colorectal cancerous cell lines of human which are widely used in medical…

Q: Microbiology a. If E. Coli has a replication time of 20 minutes how many E.coli will there be…

A: The bacterial cell cycle involves the formation of new cells through the replication of DNA and…

Q: Nar ang be detail three (3) disadvantages of differential

A: Differential centrifugation is used to separate various organic lease and subcellular organelles of…

Q: The fallowing series of dilution was prepared from a specimen to determine the number of bacteria.…

A: The viable count method is a commonly used technique in a microbiology laboratory to access the…

Q: Besides agarosc gel electrophoresis, there is also macromolccules. Differentiate both these methods.…

A: Agarose gel electrophoresis and SDS-PAGE are techniques for separation of macromolecules.

Q: Antibiotic sensitivity testing: The Kirby-Bauer. 1) What do the following terms mean? a. PPNG b.…

A: Antibiotic sensitivity testing is a laboratory technique used to determine the susceptibility of…

Q: The student advises using the same selection procedures and inoculating a 5 mL overnight culture…

A: Quantification: The process of plating on agar plates enables the counting of individual colonies,…

Q: Explain 2 possible consequences of accidentally puncturing one of the wells in the agarose gel in an…

A: The chromosomes in our cell cores comprise of huge strands of DNA. These strands are awkward when…

Q: You are a group of microbiologists tasked to test the presence of coliforms in the newly built water…

A: Coliform is a broad term used for gram-negative, rod-shaped, motile or immotile bacteria that are…

Q: bactericidal

A: Answer :: Bactericidal antibiotics will act by killing the bacterial cells and bacteriostatic…

Q: Correctly identify the steps and outcomes in the process of screening for a nutritional mutant of a…

A: Culture medium or nutrient medium is a place, mainly in petridis where microorganism utilise there…

Q: present briefly the principle of size exclusion chromatography. give a brief description of the use…

A: Here, the particles are separated on the basis of their size. In this chromatography the column is…

Q: Include a maximum of 3 sentences, a brief description of their growth.

A: Bacteriophage --- Bacteriophage ( phages ) are viruses which infect the bacteria and kill the…

Q: Topic: Isolation of E. coli bacteriophage What would happen if: - the enrichment method in the…

A: 1. The enrichment method includes the use of enrichment broth which is essential for the growth of a…

Q: 1. How may the following growth and culture conditions affect the length of the lag phase? EXPLAIN…

A: a) In case the inoculum is from an old culture than the lag phase will get extended. This is because…

Q: 6. DNA electrophoresis uses polyacrylamide gel for separation. a) True b) False 7. Agarose is a…

A: DNA is composed of nucleotides attached via phosphodiester bonds. DNA act as genetic material in…

Q: 1. Explain how CRISPR is the future of our society.

A: DNA sequencing is the process of determining the nucleic acid sequence. It is the order of…

Question

Laboratory 5 – Rapid Purification of Plasmid DNA
Next, address why the examination of the restriction digestion on an agarose gel
is a necessary step before proceeding with the ligation and transformation step.
ntroducio
depes
successfully make a new recombinant DNA molecule in the next lab exercises (Lab 6-
8)? Why?
Based on the answers you have given above, do you think you will be able to

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb
Kpnl 4. Plasmid Z has a size of 7 kb, and the map shows Kpnl (K) and Pstl (P) cut sites relative to each other. This plasmid was digested with three different restriction enzymes 2000 bp 3500 bp Kpnl (K), Pstl (P) and Bgll (B) either alone or in combination and the samples run on an agarose gel as shown below. Where does Bgll (B) cut this plasmid ? Does the plasmid have one recognition site or two for Bg|l? Describe the Bgll cut site in this plasmid relative to the Kpnl cut Plasmid Z -7 kb Pstl site. How many bases to the left or right of the Kpnl cut site would you observe the Bgll cut site. Explain briefly. 1500 bp Pstl Ladder Kpni Psti K/P Bgl K/B KPB 7000 bp 7000 bp 5600 bp 5500 bp 4900 bp 3500 bp 2000 bp 1500 bp 1500 bp 1500 bp 1400 bp 600 bp %3D
pls help very urgent, no explaantion required, pls help asap
Question:- How many different types of alterations in chromosomal numbers are there? -How can I use the F plasmid to introduce the transfer of the URA+ gene from a wild type strain into the ura- mutant strain you isolated in Q5. -After obtaining the ura- mutant, I want to transform this ura- mutant back to wild type with a DNA sample prepared from the wild type cell. How can I achieve this transformation experimentally?
Need solution urgently
Solve 5.
Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…
Need help with question one
detail explaination asap
Help Please Supercoiled DNA migrates through an agorose gel faster than similarly sized linear DNA? True or False? Using the plasmid map, indicate where (bp region on plasmid) these enzymes cut on the plasmid. EcoR1 1. 1 Hindlll 2. 637 Bpu101 3. 14 BamHI 4. 256 To sequence a DNA plasmid, you need 1 µg of DNA. If your DNA concentration was 0.45 µg/µL. How many µl of your DNA 0.45 µg/µL is required to get 1 µg final? Answer in µl using 2 decimal places. Your Answer: Answer units >
1. Please help answer this question and show all work, thank you so much.
Please asap