Q: A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:…
A: The Central dogma defines how DNA codes for proteins, which occur in three stages: replication,…
Q: How many tRNA molecules can associate with a ribosome at any given time during translation
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: Self-bonded and looped sequences near the end of single poly-ribonucleotide chains control gene…
A: Gene is the sequence of nucleotide that encodes a specific protein.
Q: codons are part of the molecular structure of
A:
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA…
A: The translation is a process in which the genetic information in the mRNA strand is converted into…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG
Q: de, translate the mRNA into an amino acid sequence.
A: Translation: It is the process by which sequence mRNA get translated into the sequence of amino acid…
Q: What is the tRNA strand for the following mRNA strand: CAGGAUGAAUUGCUC
A: To determine the tRNA (transfer RNA) sequence corresponding to the given mRNA (messenger RNA)…
Q: ICH one is the next tRNA that will arrive to the "A" site of this ribosome? 000000 Gly Arg Glu Pro…
A: The A site is where the next tRNA molecule carrying an amino acid binds to the mRNA. The tRNA…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: An mRNA has the following sequence: 5′–AUG UAC UAU GGG GCG UAA–3′ Describe the amino acid sequence…
A: mRNA is a single-stranded RNA molecule that is complementary to one of the DNA strands of a gene. It…
Q: Codons in mRNA molecule and their corresponding amino acids UUU UUA GCA AAG GOU nonsense Refer to…
A: Genetic codes are genetic information present in the nucleotide sequences of mRNA (messenger RNA)…
Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…
A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…
Q: What's the tRNA strand for the following mRNA strand: AUGGCUAACCUUGUA
A: Gene expression is the procedure through which data from a gene is employed in the production of a…
Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…
A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’…
A: The terms used in the question represents the molecules involved in gene expression. A gene is a…
Q: Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence…
A: Genetic information in our body is stored in form of DNA. DNA multiples itself by replication. DNA…
Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: a codon on a strand of messenger RNA corresponds to a what
A: Messenger RNA is formed by a process called transcription in which a template strand of DNA is…
Q: Table 1. The Genetic Code: Codons and Their Amino Acids First Two Nucleotides of Codons Last…
A: B). UUA - LEUCINE C) GAG - GLUTAMATE D) UAUCUA- TRYOSINE, LEUCINE E) AUCUUG - ISOLEUCINE, LEUCINE…
Q: The piece of eukaryotic mRNA below includes the region that codes for the binding site for the…
A: Transfer RNA, or tRNA, plays a crucial role in protein synthesis. It acts as a carrier, delivering…
Q: AGUCAGUCAG The codon chart is shown below, what amino acid sequence does the MRNA sequence: 3'…
A: The production of peptide chain or protein from the mRNA is known as translation that occurs within…
Q: Consider an image of an mRNA being translated. fMet Pro HAUG COCACG
A: In biology, "translation" refers to the second stage of protein synthesis, which is the process by…
Q: Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a…
A: DNA => Transcription => mRNA => Translation => Protein Protein synthesis is ribosome…
Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…
A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: Group I and II introns are present in the following classes of RNAS. MRNAS O miRNAS SİRNAS TRNAS
A: Mobile introns are defined as the intervening sequences. These sequences are the ones that are…
Q: why the Shine–Dalgarno sequence is important to prokaryotes？State the bases of prokayotes’ mRNA
A: Shine–Dalgarno sequence is a short stretch of polypurine sequence ( 4 to 9 purine nucleotides) in…
Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…
A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…
Q: MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA…
A: DNA => mRNA => Protein 64 codons are there for 20 amino acids. That is one amino acid can be…
Q: TRP U ARG AC LEU SER U A UG LYS PRO GAC UG GLN HIS THE MET ILE ARG a. lys-leu-cys-phe…
A: The process of the formation of a protein with the help of messenger RNA in the ribosomes is called…
Step by step
Solved in 2 steps
- During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, IISA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omisshelpp, if u could do this one first please
- Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
- TATA TATAAT ATG STOP codon(s) AGGAGG CCUCCU ACCATEG GACA NAMENNI KEHIAKET III 11 11 11 11 Universal START codon Anti-Shine-Dalgama sequence found on ribosome Shine-Dalgamo consensus sequence Prokaryotic motif for RNAP RNA transcription termination motif downstream of STOP codon where CPSF binds Kozak consensus sequence Eukaryotic motif upstream of TATA Eukaryotic motif for RNA pol TAA and TAG and TGA Prokaryotic motif upstream of TATAATRNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- mRNA sequence of A gene Find 5’ UTR and 3’UTR of mRNA 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding protein sequence
