Answered: 43/ 50 Which of the following molecular…

Science

Biology

43/ 50 Which of the following molecular structures contan codons? A a protein B mRNA CIRNA DIRNA EB and C

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 2CT

See similar textbooks

Related questions

Q: In the following "gene library" cloning experiment. Digested genomic DNA AmpR gene TCR gene TCR is…

A: Please follow step 2 for detailed explanation.

Q: In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The relative…

A: Introduction Evolution is a process involving a change in the genetic composition of a population…

Q: True or false: 1. Appendix 3 of CITES includes all species which any party identifies as being…

A: All statements are true

Q: 5-ccuaaucg-34 3'-acctgcctataccggattagetetgatectaagcatgte-5" The diagram above shows an RNA primer…

A: Given - RNA primer : B 5'-ccuaaucg-3" C Template strand : A…

Q: Label the following parts in the picture: Funiculus Embryo Sac…

A: A developed ovule comprises of a tail and a body. The tail or the funiculus (likewise called…

Q: What are the 4 aspects of the correct anatomical position?

A: Introduction: Anatomical position refers to the skin orientation required to define body anatomy. By…

Q: What is the mode of inheritance of rare Marfan based on the given pedigree? I ☐TO 2 C. Autosomal…

A: Pedigree analysis helps us identifying the inheritance pattern of a particular disease by observing…

Q: What is apoptosis and how is it utilized as a quality control mechanism in cellular and humoral…

A: Q What is apoptosis and how is it utilized as a quality control mechanism in cellular and humoral…

Q: Temperature (°C) 1 10 15 20 25 30 Concentration of Oxygen in Water Oxygen Concentration in…

A: The warmer water contains low amount of dissolved oxygen than the cold water. This is because the…

Q: Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yes or no 20…

A: The eukaryotic organisms have well defined nucleus in the cell. The messenger RNA is synthesized by…

Q: 1.What is the difference between the CNS and the PNS?

A: Introduction The nervous system is a highly complex part of an animal that organises its actions…

Q: In terms of the history of microbiology, which of the following matches is NOT correct? A. van…

A: Antony van Leeuwenhoek was the first person to observe a microorganism, he used a microscope made by…

Q: Give FOUR criteria for identifying a substance as a neurotransmitter.

A: Introduction A neuron releases a signalling chemical called a neurotransmitter across a synaptic…

Q: All tRNA molecules have poly (A) tails at their 3' end. Yes or no

A: Introduction: Ribonucleic acid (RNA) is a nucleic acid that has structural similarities to DNA and…

Q: Which of the following is NOT a reason for claims being denied?

A: All step 2 solution indicate that option 2 is correct Diminished Standard of Care

Q: one of sectioning method problem the tissue cannot stain because of The tissue was exposed to high…

A: Staining is a technique used to enhance contrast in samples, generally at the microscopic level.

Q: Label the ventral external features of the frog’s heart

A: Frogs have a closed circulatory system in which blood is circulated through vessels (tube-like…

Q: What is hypermnesia? A. when children are asked the same question a second time after a delay, they…

A: Introduction An amnesia is a dramatic form of memory loss that can be classified into a few types:…

Q: Briefly explain the relationship between substrate concentration and enzyme activity and be sure to…

A: Introduction The rate at which enzymes transform substrate molecules into product molecules is…

Q: Retrotransposons are nonviral genetic elements that facilitate their own movement within the genome…

A: 1.True Retrotransposons comprise a large portion of mammalian genomes. They contribute to…

Q: electron microscope It is a special type of microscope having a high resolution of images, able to…

A: Electron microscope Electron microscope utilise is electrons as a source of illumination for…

Q: Fill in the blanks: are gametes that is formed through spermatogenesis in the frogs testes.

A: Introduction: Gametes are cells that are involved in sexual reproduction and are created by a…

Q: What is expected to happen to the f(a) when the population is experiencing gene flow from another…

A: 1) Gene flow is the migration of a gene from one population to another. It occurs when some…

Q: dichotomous key of this creature the format should be like in the picture number 2

A: A dichotomous key is used to classify organisms on the basis of external characters. The concerned…

Q: wrinkle of tissue inside thev section * because of drawing of dehydration solution is not compeletly…

A: Introduction Histology is a field of biology that investigates the structure and composition of…

Q: Name and in brief describe the process by which immunological diversity is generated ?

A: Introduction Antibodies can be induced by virtually all microorganisms. Antibodies must be diverse…

Q: What is DNA Paternal testing? How does it work? and How reliable and accurate is this test?

A: Introduction DNA is an organic molecule that holds instructions for synthesising proteins as well…

Q: 1. A gene is mohybrid erozygous -mozygous ouble helix phenotype if the alleles for a trait are the…

A: A gene is a unit of hereditary information.

Q: Transcribed Image Text:Complete the following tasks. You discovered that a species of bacteria can…

A: Introduction Gel electrophoresis is a laboratory technique for separating DNA, RNA, and protein…

Q: Give a brief description of what the term ‘native protein’ state refers to. Your answer should make…

A: Introduction: Proteins are biological polymers made up of amino acids connected covalently by…

Q: Identify and explain in what ways does west nile virus impact human health

A: Introduction :- The West Nile Virus belongs to the Flaviviridae family of viruses, which also…

Q: The following is the PCR reaction that is programmed in the thermocycler to amplify the cheek cell…

A: PCR ( polymerase chain reaction ) is a technique in which numerous copies of DNA are synthesized .…

Q: Most amino acids are coded for, by more than one codon. Consequently the genetic code is…

A: Introduction: The genetic code is a set of laws that define how DNA's four-letter code is translated…

Q: 46 What is the A-site of the ribosome? A. exit site b. aminoacyl-tRNA binding site c. peptidyl-tRNA…

A: Ribosomes are the protein factories of the cell. These are responsible for protein synthesis by…

Q: If 1% of a human population has a recessive phenotype, what percentage has the dominate phenotype,…

A: Please follow step 2 for detailed explanation.

Q: In what two major classes can all neurotransmitter receptors be divided? What are the main…

A: Introduction Neurotransmitter receptors, also called neuroreceptors, are membrane-bound proteins…

Q: What implications does this all have on the ability to perform curls and pull-ups using "overhand"…

A: Introduction Muscles are soft tissues and have the ability to contract and therefore move the other…

Q: 63 Neonatal hyperbilirubinemia is usually treated with phototherapy, resulting in prompt reduction…

A: Introduction Jaundice is an illness in which a high level of bilirubin, a yellow-orange bile…

Q: 59 Walter Gilbert coined the term ( ) for an intervening sequence that is removed during the…

A: 59. Walter Gilbert coined the term Introns for an intervening sequence that is removed during the…

Q: Streptokinase is an enzyme produced by Streptococci bacteria and is used to digest fibrin clots. It…

A: Introduction Streptokinase (SK) is an enzyme and thrombolytic drug. In some cases of myocardial…

Q: In the space given below draw a α galactose and a βGlucose.

A: The glucose and galactose both are the examples of monosaccharide, the simple sugars. They both are…

Q: Which of the following statements about Mendelian or complex disease is TRUE? Question options:…

A: Introduction Quantitative trait locus analysis is a statistical technique that combines phenotypic…

Q: Differences between replication and transcription include: O Both DNA strands are replicated but…

A: Both DNA replication and Transcription involve the generation of a new copy of the DNA in a cell.

Q: Which of the following statements is true regarding the process of glycolysis? It both requires the…

A: Introduction Glycolysis is the process of reaction by which one molecule of glucose is converted to…

Q: In a randomly breeding population, the frequency of the dominant allele (D) is 0.8. The relative…

A: Introduction Natural selection is a phenomenon in which organisms possessing favorable traits are…

Q: 1)post translational processing of polypeptide chains including…

A: Protein synthesis or translation is the process by which mRNA is translated into protein using tRNA…

Q: Create a Research Titles and the Possible Questions about it, and please indicate what you will do…

A: COVID-19 is a respiratory infection which is caused by the SARS-CoV2 virus. This virus enters…

Q: For a successful direct staining, one should A. use a minimal amount of water to speed up the…

A: Direct staining is the process to make slides using a single stain or dye.

Q: Good hand written explanation Asap Briefly describe the 2-dimensional and 3-dimensional structure…

A: Introduction tRNA or transfer RNA is a type of RNA molecule. It plays an important role in…

Q: 2 Why is the slowing of the cilia lining the bronchi especially dangerous?

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

50
Which of the following molecular structures contan codons?
A a protein
B mRNA
CIRNA
DIRNA
EB and C

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Most codons specify an _________ . a. protein c. amino acid b. polypeptide d. mRNA
codon: 1 2 3 4 5 6 7 sequence: TAC ATG GAC AAT GAT TAG GGG 1. What is the sequence of the peptide that would result following translation with a ribosome? Write your answer like this Met Ala Gly...... 2. What mutation(s) would change the peptide to Met Asp Asn Gly Leu Gly ? Use the codon numbers to help describe where the mutation is located . What mutation(s) would eliminate peptide translation? Use the codon numbers to help describe where the mutation is located
SA p PDF as trasc d PDF During the translation of an mRNA segment, different activated tRNAs (aatRNAs)-specified here by their anticodons written 3' to 5' bind through hydrogen bonds to mRNA in subscripts-successively codons in the following order: Teas fill PDF Cave UNOFFIC aatRNAGAA binds, then aatRNACAC, then aatRNAUUG, then aatRNAGUU, then aatRNAGUG, then aatRNAGAC What would the sequence of that mRNA segment be? O GAA CAC UUG GUU GUG GAC O CUU GUG AAC CAA CAC CUG O CTT GTG AAC CAA CAC CTG O Glu-His-Leu-Val-Val-Asp hu O Search PD maste omiss
During translation, the tRNA antlicodon sequence G-A-U vyould blnd to which MRNA codon (plck one of the cholces I -V below)? Note: all of the sequencos for tho quostlon and answors use the standard convention for representing ollgonuclootidos discussed In class whoro tho 5'-ond Is at the loft and the 3'-ond Is at the right. I) G-A-U II) U-A-G I) C-U-A IV) A-U-C V A-T-C OA. none of the cholces OB. IV Oc." OD.! OE, II
10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence an
MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
mRNA sequence of A gene Find start codon and stop codon 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCCUACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACGACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGCUGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGAGGUAGAAGCCGCUGGGGCUUGGGGCU-3’
Explain The mRNA codon of valine is: GUC UGG CCA TTG
"a messenger rna is 423 long how many amino acids it can code"
For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A G
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′