ing the following DNA sequence determine the amino acid sequence: AGAGGTCCGCGTTTAGACAT5' et Val Ser Arg Arg Lys Ser Val I Leu Pro Gly Arg Lys Ser Met et Ser Lys Arg Gly Pro Leu Val I Ser Lys Arg Arg Ser Val Met the answer is A, but how do I do it? e if each statement refers to prokaryotic cells, eukaryotic cells or both. ding and lagging strands form during DNA replicationc S complete ribosomal subunit JA replication is coordinated to the cell cycle. rcular DNA
Proteins
We generally tend to think of proteins only from a dietary lens, as a component of what we eat. However, they are among the most important and abundant organic macromolecules in the human body, with diverse structures and functions. Every cell contains thousands and thousands of proteins, each with specific functions. Some help in the formation of cellular membrane or walls, some help the cell to move, others act as messages or signals and flow seamlessly from one cell to another, carrying information.
Protein Expression
The method by which living organisms synthesize proteins and further modify and regulate them is called protein expression. Protein expression plays a significant role in several types of research and is highly utilized in molecular biology, biochemistry, and protein research laboratories.
Step by step
Solved in 2 steps