In biotechnology, gene cloning is a crucial technique used in many genetic modificationexperiments. A vector is normally required to perform this process. The vector commonlyused to transform a bacterial host cell is known as a plasmid. Below is the general plasmidmap of pBR322. Elaborate the functions of ori, Ap and TeR present in pBR322.Bul 3759Prul 3733PM 3507BDI 3602Asel 3537Bal 3433Finci 3905Scal 38443787Bad 3420Ahdi 3361Acul 3000AlwNI 2884Sspl 4168Earl 4155Acul 4048Xust 3961Bell 2777Bc1 2682oriAall-Zeal 4284BeiVI 4209B 4205Del 2575Pail-Att 2473BAB 2404EcoRI 4350Earl 2351BspQI-Sapl 2350Ndel 2295BAP 2291178-Accl 2244Cial-Ispit 23Hindill 29pBR3224,361 bpBall 2225TthJ11- Part 2217ropEcoRY 185Bmtl-Nhel 229Hamill 375Sgr 400Ball 471Xml 2029Pull 2064Dalt 2162BamB 2122Banil 485Bigl 128Sphl 582EcoN1 822Sall-Accl-Hell 651Pshu 712BsaBl 1668Engl 939BeY1 945Nrul 972BAPT 1045BspMI-BfuM 1063PAMI 1315Bumi 1353Bgl 1650BapEl 1664P1364Styl 1389Aval-Bsol 1425PpuM 1438Msel 1444Bigl 1447PMI 1480

In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid map of pBR322. Elaborate the functions of ori, ApR and TeR present in pBR322. Bul 3759 Prul 3733 пы 3787 Pull 3607 Barbi 3002 Asel 3537 Bal 3433 Bad 3420 Floci 3905 Scal 3844 Ahdi 3361 Acul 3000" AlwNI 2884 Earl 4155, Acul 4048 Xest 3961 Bell 2777 Bef1 2682 Aatll-Zel 4284 BI 4209 B 4205 Sspl 4168 Dell 2575 Poil-Att 2473 BarB 2404 Troll 450 Earl 2351 BspQI-Sapl 2350 Ndel 2295 BAP 2291 171-A 2244 Cial-Ispt 23 Hindill 29 pBR322 4,361 bp Ball 2225 Th1111 - Part 2217 rop EcoRY 185 Bmtl-Nhel 229 Hamill 375 Xml 2029 Pull 2064 BamB 2122 Dell 2182 Sgr 400 Ball 471 Bani 485 Bigl 128 Sphl 562 EcoN1 822 Sall-Acol-Hinell 651 Pshu 712 Engl 939 BY1 949 Nrul 972 BAPT 1045 BspMi-fuAl 1063 PAMI 1315 Bami 1383 PM 1364 Styl 1309 Aval-Boll 1425 PMI 1438 Msel 1444 Bigl 1447 PMI 1480 Bgl 1650 Bap 1664 BsaBl 1668

In biotechnology, gene cloning is a crucial technique used in many genetic modification experiments. A vector is normally required to perform this process. The vector commonly used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid map of pBR322. Elaborate the functions of ori, ApR and TeR present in pBR322. Bul 3759 Prul 3733 пы 3787 Pull 3607 Barbi 3002 Asel 3537 Bal 3433 Bad 3420 Floci 3905 Scal 3844 Ahdi 3361 Acul 3000" AlwNI 2884 Earl 4155, Acul 4048 Xest 3961 Bell 2777 Bef1 2682 Aatll-Zel 4284 BI 4209 B 4205 Sspl 4168 Dell 2575 Poil-Att 2473 BarB 2404 Troll 450 Earl 2351 BspQI-Sapl 2350 Ndel 2295 BAP 2291 171-A 2244 Cial-Ispt 23 Hindill 29 pBR322 4,361 bp Ball 2225 Th1111 - Part 2217 rop EcoRY 185 Bmtl-Nhel 229 Hamill 375 Xml 2029 Pull 2064 BamB 2122 Dell 2182 Sgr 400 Ball 471 Bani 485 Bigl 128 Sphl 562 EcoN1 822 Sall-Acol-Hinell 651 Pshu 712 Engl 939 BY1 949 Nrul 972 BAPT 1045 BspMi-fuAl 1063 PAMI 1315 Bami 1383 PM 1364 Styl 1309 Aval-Boll 1425 PMI 1438 Msel 1444 Bigl 1447 PMI 1480 Bgl 1650 Bap 1664 BsaBl 1668

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 20QP: Analyzing Cloned Sequences A base change (A to T) is the mutational event that created the mutant...

See similar textbooks

Related questions

Q: Early gene-cloning experiments involved insertion at one restriction site in the vector; for…

A: Answer: Introduction: Restriction endonucleases enzymes which cut DNA at precise recognition sites.…

Q: Colonies/ug of plasmid) based on these results? O about 140O O about 800 O about 4000 O about 400…

A: INTRODUCTION Transformation efficiency is that the efficiency by which cells can take up…

Q: You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid…

A: Deoxyribonucleic acid ( DNA) is the molecule that carries genetic information for an organism.The…

Q: Discuss the importance on the addition of ampicillin and arabinose to the medium of the genetically…

A: pGLO bacterial transformation experiment. Controls that were incubated with no plasmid (-pGLO) grow…

Q: 35) A researcher inserted DNA fragments from an organism into expression vector plasmids and…

A: A plasmid is a small, circular, extra double stranded molecule of DNA that is being different from…

Q: You are cloning a gene from a eukaryotic organism into a plasmid to produce a recombinant protein in…

A: The biological process by which naked DNA (deoxyribonucleic acid) gets transferred from one…

Q: What is blue/white screening? What is the key feature of a plasmid that is used for it?

A: The blue-white screen is a screening technique that allows for the rapid and convenient detection of…

Q: A eukaryotic gene is added to a mixture containing a restriction enzyme EcoRI and a bacterial…

A: Which media allow growth of bacteria that did not take up any plasmid?

Q: Please place the stages of a CRISPR-cas9 gene editing workflow in the correct order below. Note,…

A: CRISPR-Cas9 gene editing is a powerful molecular tool that allows scientists to selectively modify…

Q: Margaret has been given a plasmid containing her favorite gene, afg (Margaret’s favorite gene). The…

A: First, convert the amount of plasmid from micrograms (μg) to nanograms (ng) since the concentration…

Q: Bacterial systems serve as an excellent model to express proteins but has a disadvantage – what is…

A: Expression of genes: Gene expression is the process of a gene being translated into a functioning…

Q: You are employed in a gene therapy laboratory to test the effectiveness of a vector for correcting…

A: The CFTR gene encodes the CFTR protein (cystic fibrosis transmembrane conductance regulator). It is…

Q: Please help urgently

A: Conjugation is the process that explain the reproduction module in various bacteria species.

Q: A newly discovered insect has a genomic DNA that does not contain any repetitive DNA or any intronic…

A: Biotechnology is the use of our understanding of biological processes to develop useful applications…

Q: Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are…

A: Introduction :- A cloning vector is a short bit of foreign DNA that can be injected for cloning…

Q: Competent E. coli cells were transformed with the PGLO plasmid. These transformed cells were then…

A: pGLO plasmid is an engineered plasmid which contains DNA sequence that enable it's replication and…

Q: A plasmid has been modified such that it carries the gene for beta-galactosidase (lacZ) under the…

A: The given plasmid contains the LacZ gene under the control of the lac promoter. The same plasmid…

Q: You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid…

A: PBR322 is a cloning vector which is widely used for cloning purposes. The map of PBR322 is given in…

Concept explainers

Bacterial Genomics

The study of the morphological, physiological, and evolutionary aspects of the bacterial genome is referred to as bacterial genomics. This subdisciplinary field aids in understanding how genes are assembled into genomes. Further, bacterial or microbial genomics has helped researchers in understanding the pathogenicity of bacteria and other microbes.

Transformation Experiment in Bacteria

In the discovery of genetic material, the experiment conducted by Frederick Griffith on Streptococcus pneumonia proved to be a stepping stone.

Plasmids and Vectors

The DNA molecule that exists in a circular shape and is smaller in size which is capable of its replication is called Plasmids. In other words, it is called extra-chromosomal plasmid DNA. Vectors are the molecule which is capable of carrying genetic material which can be transferred into another cell and further carry out replication and expression. Plasmids can act as vectors.

Question

In biotechnology, gene cloning is a crucial technique used in many genetic modification
experiments. A vector is normally required to perform this process. The vector commonly
used to transform a bacterial host cell is known as a plasmid. Below is the general plasmid
map of pBR322. Elaborate the functions of ori, Ap and TeR present in pBR322.
Bul 3759
Prul 3733
PM 3507
BDI 3602
Asel 3537
Bal 3433
Finci 3905
Scal 3844
3787
Bad 3420
Ahdi 3361
Acul 3000
AlwNI 2884
Sspl 4168
Earl 4155
Acul 4048
Xust 3961
Bell 2777
Bc1 2682
ori
Aall-Zeal 4284
BeiVI 4209
B 4205
Del 2575
Pail-Att 2473
BAB 2404
EcoRI 4350
Earl 2351
BspQI-Sapl 2350
Ndel 2295
BAP 2291
178-Accl 2244
Cial-Ispit 23
Hindill 29
pBR322
4,361 bp
Ball 2225
TthJ11- Part 2217
rop
EcoRY 185
Bmtl-Nhel 229
Hamill 375
Sgr 400
Ball 471
Xml 2029
Pull 2064
Dalt 2162
BamB 2122
Banil 485
Bigl 128
Sphl 582
EcoN1 822
Sall-Accl-Hell 651
Pshu 712
BsaBl 1668
Engl 939
BeY1 945
Nrul 972
BAPT 1045
BspMI-BfuM 1063
PAMI 1315
Bumi 1353
Bgl 1650
BapEl 1664
P1364
Styl 1389
Aval-Bsol 1425
PpuM 1438
Msel 1444
Bigl 1447
PMI 1480

Expert Solution

Step 1

Vectors are the vehicles that carry genes of interest and transmit into another organism . It is classified into:-

I ) Cloning vector

II ) Expression vector

Out of which, cloning vectors are further classified into:-

a ) Plasmid vector

b ) Bacteriophage vector

c ) Cosmid vector

d ) Artificial chromosome

Step by step

Solved in 5 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…
Please DESCRIBE, in outline form, the method you will use to select for bacterial cells that have taken up the pL311 plasmid, and to screen those cells for the presence of plasmids that are likely to contain a cloned gene. Be sure to mention the specific media you will use. In addition, please explain the rationale behind this specific selection and screening procedure. (Remember that you have available the following types of media: (i) media containing neither kanamycin nor X-gal, (ii) media containing BOTH kanamycin and X-gal, (iii) media containing tetracycline, and (iv) media containing ampicillin.
Which of the delivery techniques mentioned in Table 2 can be used to best transfer recombinant plasmids into E. coli cells
Using the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.
Once cloning is complete, a recombinant OXA-M290 protein can be produced in E. coli. Competent E. coli BL21(DE3) cells are transformed with the pET-28a-OXA-M290 plasmid, and the transformed cells are grown on an agar plate that contains kanamycin. The E. coli BL21(DE3) cells transformed with the pET-28a-OXA-M290 vector are next grown in liquid growth media that contains kanamycin. Once the culture reaches an OD600 of 0.6, isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to a final concentration of 0.5 mM to induce protein production. How does the addition of IPTG result in the transcription of genes that are regulated by the T7 promoter in E. coli BL21(DE3) cells? [4 – 6 sentences suggested] For Context ONLY: For this biology course and based on the results obtained from a previous BLAST search, the bacteria responsible for the infection at a Hospital is most likely a new strain of Escherichia coli. This strain is given the name E. coli AFB. Earlier, BLAST was used to study a…
Cloning vectors are not just limited to bacterial plasmids. Bacteriophages and M13 phage vectors are also commonly utilized in the cloning process. State any five (5) key criteria to be an effective cloning vector.
Besides the pUC series, there are other plasmid vectors in the market such as pBR327 and pGEM-T. Some vectors are designed specifically for TA cloning while some are not. What is TA cloning? Explain in detail.
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker(such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
As a part of undergrad lab project, you have to clone Your Favorite Gene into plasmid cloning vector (4740 bp) pUC18. Restriction maps for both YFG and cloning vector are provided. The plasmid has a bacterial origin of replication (ori), an ampicillin resistance gene (AmpR) that degrades ampicillin antibiotic. It also has LacZ gene that encodes the β-gal enzyme, which converts white X-gal substrate into a blue product. pLac is a bacterial promoter. Restriction Enzyme Recognition Site : A slash (/) represents the cut site for each restriction enzyme. Enzyme 1 5’- G/TCGA C -3’ 3’- C AGCT/G-5’ Enzyme 2 5’-C/TCGA G-3’ 3’G AGCT/ C5’ Enzyme 3 5’- GTC / GAC- 3’ 3’- CAG / CTG- 5’ Enzyme 4 5’-C AATT /G-3’ 3’-G/ TTAA C-5’ Enzyme 5 5’C AATT/G-3’ 3’G/TTAA C-5’ Enzyme 6 5’G/GATC C-3’ 3’C CTAG/ G-5’ Enzyme 7 5’G/GATC C-3’ 3’C CTAG/ G-5’ 1a) The table below shows restriction enzyme pairs used by various teams to digest the YFG and clone it in the…
A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEP), Yeast Integrating Plasmid (YIP) and Yeast Replicating Plasmid (YRP). Why is YEP preferred over YIP and YRP? Give your thoughts on this.
Decide on two restriction sites that you can use to clone this into pL4440’s MCS. Identify their sequence and explain why. Tip: The plasmid map is showed below, details of restriction site sequences can be found at https://enzymefinder.neb.com/#!#nebheader
None