In addition to the predominant adult hemoglobin,HbA, which contains two α-globin chains and twoβ-globin chains (α2β2), there is a minor hemoglobin,HbA2, composed of two α and two δ chains (α2δ2).The β- and δ-globin genes are arranged in tandem andare highly homologous. Draw the chromosomes thatwould result from an event of unequal crossing-overbetween the β and δ genes

Q: Let’s suppose that a species of mosquito has two different types ofsimple transposons that we will…

A: Sequence of DNA, changes the position in the genome, at times, it reverses or creates mutation,…

Q: 3.9 Which mode of inheritance is suggested by the fol- lowing pedigree? Based on this hypothesis,…

A: Pedigree is a diagrammatic representation of either phenotypes or genotypes of a particular organism…

Q: Mitotic recombination can occasionally produce a twin spot.Let’s suppose an animal species is…

A: It is given to suppose that if an animal species is heterozygous for the 2 gene governing fur colour…

Q: Ehler-Danlos syndrome is a rare disorder caused by a mutation ina gene that encodes a protein called…

A: Sir Gregor Mendel was a priest and a teacher who did the famous hybridization experiment on garden…

Q: Alleles of genes A and B were analyzed in Neurospora according to the cross shown below. Ordered…

A: The four haploid cells are produced by the process of meiosis and three kinds of patterns of growth…

Q: An Hfrstrain that is a * b*c* d* ef g h*is mated with an F strain that is a b cd e fgh .The mating…

A: The gene that is transferred in the least time (that is during first interruption) is the first gene…

Q: To detect the CAG repeat expansion with a particular gene where 30 repeats in Normal changes to 250…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: inheritance of a mutation that causes the mitochondrial disease MERFF.

A: The question is asking which of the three possibilities (heteroplasmic, homoplasmic, or homozygous)…

Q: WHIM syndrome is a disease of the immunesystem resulting in warts and frequent infections.The…

A: WHIM syndrome is an autosomal dominant combined deficiency of the immune system and is caused by the…

Q: Below is a pedigree from one family (two parents and eight children). Four of the children…

A: Pedigree chart It is a diagram that represents the occurrence of phenotypes of a particular gene in…

Q: HindIIIrecognizes the sequence AAGCTT and cleaves between the two A's. What type of end is produced…

A:

Q: In McCune-Albright syndrome, fibrous connective tissue replaces bone, tan patches (café-au-lait…

A: A mutation is considered a change in the DNA sequence, which can be either an addition or deletion…

Q: Ehler-Danlos syndrome is a rare disorder caused by a mutation ina gene that encodes a protein called…

A: The Ehler-Danlossyndrome is a disorder caused by a mutation in the gene codes for the protein…

Q: Typically, most of the nucleotide variability that occurs within a geneticlocus does not affect the…

A: The total number of genetic traits present in the genetic composition of a species is known as…

Q: A particular disease is found in a group of South AmericanIndians. During the 1920s, many of these…

A: Any abnormal condition which affects the functions or structure of either the whole body or some…

Q: In references to the "alpha-globin gene locus" or "beta-globin gene locus", the term "locus" means

A: Chromosomes are condensed form of chromatin. Chromosomes consist of two chromatids which are held…

Q: What type of chromosomal rearrangement is likely explained the evolution of human chromosome 2 from…

A: Chromosomes  The long thread like structure chromatin condensed to form thick short structure in…

Q: In each of these diagrams (A-D) homologs are shown as the same size and color. A ANE 1 C B Which of…

A: DNA is our generic career molecule. They are found in nucleus of eukaryotic cell. During propage…

Q: The dominant condition elliptocytosis causes red blood cells to become misshapen into oval-shaped…

A: answer given below

Q: Suppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal…

A: Hi! Thank you for the questions. As you have posted multiple questions, I will be answering the…

Q: In the chapter-opening photograph of kernels on an earof corn, what is the genetic basis of the…

A: Part a.The fully pigmented kernel has resulted from the wild-type copy of the C gene expressed in…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of…

A: Drosophila is a fruit fly, which has genetically 4 pairs of chromosomes in its genome. It is the…

Q: Researchers in search of loci in the human genome that arelikely to contribute to the constellation…

A: In genetic studies of human disease models, organisms are used. It is necessary to understand the…

Q: 7.13 In rabbits, the dominant allele C is required for colored fur; the recessive allele c makes the…

A: Introduction :- The relationship between two genetic variants is referred to as dominant. Each gene…

Q: You have identified a SNP marker that in one largefamily shows no recombination with the locus…

A: An SNP (Single nucleotide polymorphism) marker has been identified that shows no recombination…

Q: On Neurospora chromosome 4, the leu3 gene is just to theleft of the centromere and always segregates…

A: Introduction: During the zygotene phase, a structure known as the synaptonemal complex forms between…

Q: This pedigree traces the inheritance of a rare disease in humans. a. Based on this pedigree, is the…

A: Answer is given below.

Q: An organism has the genotype a"g*/a"g*;qt"/qtt;rth*/rth+. Indicate the correct genes/ alleles at all…

A: Chromosome X 1:a- 2:g+ 3:a- 4:g+

Q: If you assume Figure 2-15 also applies to mice and youirradiate male sperm with X rays (known to…

A: The similar regions in two chromosomes  are considered to be homologous. Hence the X and Y…

Q: From the pedigree in Figure 3-25, what principle can youdeduce about the inheritance of…

A: Answer : The pedigree shown shows a X linked recessive pattern of inheritance.

Q: Inversions are known to affect crossing-over. The following homologs have the indicated order (the…

A: Thank you for the question.  Answer : inversion is when there is disruption of a single chromosome (…

Q: A brown female (#1) with high cholesterol is mated to a black male (#2) with normal cholesterol. The…

A: The trait for high cholesterol level is dominant over low cholesterol level. The brown fur is…

Q: can two observably different cells have the same geno type, explain?

A: In biology, the genotype is the set of genes in our DNA which is responsible for a particular trait.…

Q: determining coat color is the agouti gene?

A: The coloration, pattern, and length of the cat fur is governed by numerous genes and is determined…

Q: 5) Cystic fibrosis is caused by a gene on chromosome 7 and results in the build-up of mucus in the…

A: Cystic fibrosis or (CF)- it is an inherited disorder that leads to severe damage to digestive…

Q: Tay–Sachs disease is caused by loss-of-function mutations ina gene on chromosome 15 that encodes a…

A: Tay–Sachs disease can be defined as a hereditary condition that causes nerve cells present in the…

Q: In Figure 6-21, propose a specific genetic explanationfor individual Q (give a possible genotype,…

A: Examples of diseases showing an incomplete penetrance are Huntington's disease and breast cancer.…

Q: In an in situ hybridization experiment, a certain clonebound to only the X chromosome in a boy with…

A: In situ hybridization is a sort of hybridization in which a labelled complementary DNA, RNA, or…

Q: Assume that the Holliday junctions resolve so that there is no crossing over (that is, there is no…

A: For the maternal chromosome and paternal chromosome see below.

Q: Based on the information provided, you can infer that individual III-1 inherited both the      A.)…

A: A pedigree is a graph that shows how a characteristic or medical condition is passed down via family…

Q: A couple planning their family are aware that through the past three generations on the husband's…

A: a. Inversions are quite uncommon, thus little is understood about how they affect phenotype and…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.