Answered: Are the epsilon (ε) and beta (β) genes…

Science

Biology

Are the epsilon (ε) and beta (β) genes on chromosome 11 orthologs or paralogs? Explain your answer.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter6: Cytogenetics: Karyotypes And Chromosome Aberrations

Section: Chapter Questions

Problem 24QP: A geneticist discovers that a girl with Down syndrome has a Robertsonian translocation involving...

See similar textbooks

Similar questions

Human adult hemoglobin is a tetramer containing two alpha (a) and two beta (b) polypeptide chains. The a gene cluster on chromosome 16 and the b gene cluster on chromosome 11 share amino acid similarities such that 61 of the amino acids of the a@globin polypeptide (141 amino acids long) are shared in identical sequence with the b@globin polypeptide (146 amino acids long). How might one explain the existence of two polypeptides with partially shared function and structure on two different chromosomes?
An STR on chromosome 5 is very closely linked to a gene involved in a dominant metabolism disorder (one one copy of the mutation causes the disease). There are four different alleles of the STR (Q, B, S, and L), each with different numbers of GATCTCG repeats. The S allele has 2 repeats, the B allele has 7 repeats, the Q allele has 10 repeats, and the L allele has 5 repeats. Part 1 Lane 1 of the gel shown below indicates the locations of PCR products corresponding to all four STR alleles when run together in one lane. DNA was loaded into the wells at the top of the gel. Move the letter of each allele to its correct position at the left of Lane 1 to indicate where each allele runs on the gel. 0000 Gabriel Andre Lane 1 O Maria Andre Maria Juliana B L Part 2 Andre and Maria are the parents in this family; all others shown on the gel are children. Daughter Juliana is born with the metabolism disorder, but daughter Camila does not have the disorder. Assuming no recombination between the STR…
Colchicine is a chemical mutagen that inhibits the spindle formation and prevents anaphase, which retains the cell’s single restitution nucleus (doubled chromosome number). Suppose that an onion (2n=16) is subjected to three consecutive rounds of colchicine treatment, what will be the resulting chromosome number of the treated onion?
Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin numerical digits only.
Suppose, you want to detect the CAG repeat expansion within a particular gene (30 repeats in normal changes to 250 repeats in disease) in a certain disease. How will you diagnose this disease condition? Can you identify Y chromosome microdeletion (which involves the deletion of AZF locus) using conventional karyotyping? If not, then why? How will you diagnose a chromosomal translocation event? (Discuss any one of the processes)
Why is chromosome 21 the smallest and not chromosome 22? considering that a karyogram is arranged from largest to smallest
Rice has a chromosome number of 2n = 24. If different euploids and anaeuploids are available in rice, identifythe chromosomal mutation, chromosome configuration, chromosome number, and/or type of gametes in each of the mutations below. Complete the table. Example: for 10B, the answer is "10 II + 2 I"
a) Are the genes linked? Please explain SPECIFICALLY how you can distinguish between linked and unlinked genes in this instance. b) If the two genes are linked, calculate the % recombination between ser and thr. Show the formula used, as well as all of your calculations. c) Draw a single map illustrating the arrangement of the two genes on the chromosome with respect to each other and to the centromere of the chromosome. Make sure to map ALL three distances.
Approximately how many copies of chromosome 2 are found in a polytene chromosome in Drosophila?
Map distances were determined for four differentgenes (MAT, HIS4, THR4, and LEU2) on chromosome III of the yeast Saccharomyces cerevisiae:HIS4 ↔ MAT 37 cMTHR4 ↔ LEU2 35 cMLEU2 ↔ HIS4 23 cMMAT ↔ LEU2 16 cMMAT ↔ THR4 20 cMWhat is the order of genes on the chromosome?
The fruit fly Drosophila melanogaster has about 2 x 10^8 base pairs of DNA per haploid genome, of which about 75% in nonrepeated DNA. The DNA is distributed among four pairs of homologous chromosomes, which have a total of about 5,000 visible bands when in polytene forms in the salivary gland. The number of genes initially estimated from mutational studies was also about 5,000 but recent DNA sequencing studies suggest that the gene number may be somewhat higher. a. Why was it tempting to speculate that each band corresponds to a single gene? What does this suggest about the number of different proteins Drosophila can make? Does that seem like a reasonable number to you? b. Assuming all the nonrepeated DNA is uniformly distributed in the chromosomes, how much nonrepeated DNA (in base pairs) is there in average band?
Rice has a chromosome number of 2n = 24. If different euploids and aneuploids are available in rice, identify the chromosomal mutation, chromosome configuration, chromosome number, and/or type of gametes in each of the mutations below. Example: For 10B, the answer is “10 II + 2 I”