Part ii. ) please i.) Fill in the table for each of the E. coli: (0) = No Activity (+)= Basal Activity and (+++) = High ActivityE. coli chromosomeF PlasmidB-gal activity?Permease activity?WhenLactose ispresentWhenLactose ispresentWhenWhenGlucose ispresentGlucose ispresent++++++a.) I+ P+ O+ Z+ Y+noneb.) I^[S] P+ O+ Z+ Y+none100.c.) I+ P+ O^[c] Z+ Y+none++++++++++++d.) I+ P+ O- Z- Y+0.none++++++e.) I+ P+ O+ Z+ Y+I^[S] P+ O+ Z+ Y+f.) I[S] P+ O+ Z- Y++ P+ O^[c] Z+ Y-9.) I^[TB] P+ O+ Z+ YI+ P+ O^[c] Z- Y+h.) I+ P+ O^[c] Z+ Y-I+ P+ O+ Z** Y+i.) I^[TB] P+ O^[c] Z+ Y- 1+ P+ O+ Z- Y+Z** is a polar mutationii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered itnonfunctional, how would that affect the level of B-galactosidase protein activity withand without lactose present, why?

First it has to be understood that : 1) the CAP-cAMP complex acts as a glucose sensor and is only…

ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of B-galactosidase protein activity with and without lactose present, why?

ii. ) If the lac operon in 'a' carried a mutation in the CAP binding site that rendered it nonfunctional, how would that affect the level of B-galactosidase protein activity with and without lactose present, why?

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter16: Adult And Pediatric Dosages Based On Body Surface Area

Section: Chapter Questions

Problem 7.2P

See similar textbooks

Similar questions

In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True False
pMBBS plasmid was subjected to complete digestion by different combinations of three restrictive enzymes (EcoRI, BamHI, and XhoI), and the results analyzed on an agarose gel, Figure 1. Using the data, respond to the question below Draw the actual map of the pMBBS plasmid, following the style of the sample map shown in Figure Make sure you show the following information: (1) relative locations of the RE sites; (2) size in base pairs of the segments of DNA between sites. (The map need not be drawn to scale.)
There can be more than one answer. Please help me
b. Cleavage with chymotrypsin produces the following fragments: Band A: CN , NLQY, GIVEQCCHKRSEY Band B: F, Y, DPTKM, IACCVRGF, RTTGHLCGKDLVNALY Cleavage with Staphilococcus aureus V8 protease produces the following fragments: Band A: GIVE, YNLQNYCN, QCCHKRCSE Band B: PTKM, RTTGHLCGKD, LVNALYIACGVRGFFYD What is the amino acid sequence of the protein? Type your response
Last week in lab you plated various E. coli mutants. This week we will be analyzing those plates. To help interpret those results, predict the growth/color pattern you'd expect for a Lacz- mutant. Table 1: Options are blue or white for NA plates; Table 2: Options are: growth or none for minimal plates). Table 1 [Select] Table 2 [Select] Xgal glucose Xgal + lactose [Select] [Select] Minimal lactose ΝΑ [Select] Xgal + IPTG [Select] maltose > [S
For E. coli strains with the lac genotypes show below, use a plus sign (+) to indicate the synthesis of β-galactosidase and permease and a minus sign (–) to indicate no synthesis of the proteins.
b. Neurospora has an arginine amino acid synthesis pathway shown below: ornithine citrulline arginine NH H2N H2N OH H2N HO HO NH2 NH2 ÑH2 Enzyme A Enzyme B Enzyme C ↑ ↑ Gene A Gene B Gene C Suppose I have a neurospora strain that has a mutation such that it will not grow unless I supplement the media (food) with arginine (but not with citrulline or ornithine). What gene is mutated? Explain your reasoning. C. Suppose I take the strain above that only grows with arginine supplements and cross it to a different mutant Neurospora strain that grows with arginine and citrulline supplements but not ornithine supplements. Assming genes A, B and C are unlinked and there is only one mutation per strain: i) What percentage of the progeny will grow on ornithine? ii) What percentage on citrulline? iii) What percentage on arginine? Show your work for i), ii) and iii). |
Calculate these for 1 ug of plasmid DNA in a final total volume of 20 ul. All enzymes being used here are at a concentration of 10 U/µL. For double digests, give the appropriate volume for each enzyme and decide which buffer to use. (HINT: look up double digest conditions on the NEB website.) You should always calculate all volumes in advance to ensure the correct working concentrations and so that you can prepare the digests as efficiently as possible. It is a good idea to check off each component as it is added to the microfuge tube. Complete the table below, including the volume of DNA sample(s) you will need for 1 pg of the DNA (from two different methods in Experiment #3) based on the concentration(s) you determined from the OD260 value, which you will restriction digest with each of the restriction enzymes singly and in double digests in Part A. For example, the volume of DNA sample that contains 1 µg DNA for DNA sample from Part A, Experiment 3: OD260 = 0.024, dilution 500x…
A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphologyis strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology? Also, describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon and why is it more likely that insertions or deletions will be more detrimental to a cell than point mutations?
TRUE OF FALSE: Is E coli colonies would be pink mucoid in Eosin Methylene BlueAgar (EMBA)? Is Coliform colonies would be pink mucoid in Eosin Methylene BlueAgar (EMBA)?
In your laboratory, you have an F− strain of E. coli that is resistantto streptomycin and is unable to metabolize lactose, but it can metabolizeglucose. Therefore, this strain can grow on a medium thatcontains glucose and streptomycin, but it cannot grow on a mediumcontaining lactose. A researcher has sent you two E. colistrains in two separate tubes. One strain, let’s call it strain A, hasan F′ factor (an F prime factor) that carries the genes that are requiredfor lactose metabolism. On its chromosome, it also has thegenes that are required for glucose metabolism. However, it is sensitiveto streptomycin. This strain can grow on a medium containinglactose or glucose, but it cannot grow if streptomycin is addedto the medium. The second strain, let’s call it strain B, is an F−strain. On its chromosome, it has the genes that are required forlactose and glucose metabolism. Strain B is also sensitive to streptomycin.Unfortunately, when strains A and B were sent to you, thelabels had fallen…
#1 HindII --- 5’ GTC ↓ GAC 3’ 5’ ACGACGTAGTCGACTTATTAT GTCGACCCGCCGCGTGTCGACCATCA 3’ 3’ TGCTGCATCAGCTGAATAATACAGCTGGGCGGCGCACAGCTGGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut: