I am a Physician Scientist and have a patient that presents withcolorectal cancer. I decide to enroll them in your study and do wholegenome sequencing on their cells. They have a lot of SNPs across theirgenome and find a novel SNP that is predicted to end in a prematurestop codon of a known member of a DNA repair pathway. You think thisis the initiating mutation that resulted in their cancer. For this patient,what DNA repair pathway are they likely deficient in?

Given the scenario you've described, where a novel SNP leads to a premature stop codon in a gene…

Answered: I am a Physician Scientist and have a…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNA
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Although the brother is an immunologically matched donor forhis sister, it would be unethical for the clinicians to transplantbone marrow from the brother to…
a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?
Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Why might mutations in genes encoding telomerase subunitslead to bone marrow failure?
5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
Tay Sachs disease is an autosomal recessive disease in which a protein – Hex A - is abnormal. To make the Hex A protein: The promoter and transcription termination sites are 33,000 base pairs apart. The Hex A protein has 600 amino acids 5’ and 3’ UTR’s are each 500 bp long. a)How many base pairs would you expect in the final mRNA? Show your work b)How many bases were spliced out? Show your work
Nonfunctional HexA protein is responsible for the autosomal recessive disease Tay Sachs. A patient with Tay Sachs produces a normal amount of full length but non-functional HexA protein. Of the choices below, what is the most likely type of mutation responsible for the disease? O a base substitution in an intron 5' splice site. a frameshift in an exon O a missense in an exon O a base substitution in an enhancer region
Dr. Serena Velazquez lands a coveted post-doc position at Johns Hopkins following completion of her MD/PhD in cancer therapeutics to treat late-stage pancreatic cancer using a mouse model. Her post-doc will be devoted to targeted mutagenesis of replicative enzymes to halt cell division in cancerous cells. She reviews mitosis and meiosis before reporting for her first day of work. 1) If Dr. Velaquez wants to target the replication fork of synthesizing DNA in eukaryotes, what proteins might she consider knocking down to see the effect on cancer progression? a) RPA. b) MCM. c) All the choices are correct. d)Topoisomerase.
Tay-Sachs disease (TSD) is a fatal genetic disorder, that results in progressive destruction of the nervous system. Tay-Sachs is caused by a mutation in the gene that codes for an enzyme called hexosaminidase-A (Hex-A). Hex A CDNA from normal and a Tay-Sachs individual was sequenced using the same primer. This is the coding strand and starts in-frame at amino acid position #78. Results are shown below. Read the darkest band in each row. Normal Tay-Sachs (-) ATG C ATG C (+) a. Write each coding strand DNA sequence, normal and Tay-Sachs 5' to 3' b. Write the amino acid sequence that will be translated from each sequence, normal and Tay-Sachs C. Describe the type of mutation? Predict the effect of this mutation on the Hex A protein.
After decades of work, Dr. Ricky M. isolated a small amount of attractase—an enzyme that produces a powerful human pheromone—from hair samples of Hollywood celebrities. to take advantage of attractase for his personal use, he obtained a complete genomic clone of the attractase gene, connected it to a strong bacterial promoter on an expression plasmid, and introduced the plasmid into E. coli cells. He was devastated to find that no attractase was produced in the cells. What is a likely explanation for his failure?

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS