Answered: How many Barr bodies will be in a body…

Name: How many Barr bodies will be in a body cell of an XY male?
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: How many Barr bodies will be in a body cell of an XY male?

Science

Biology

How many Barr bodies will be in a body cell of an XY male?

Human Physiology: From Cells to Systems (MindTap Course List)

9th Edition

ISBN:9781285866932

Author:Lauralee Sherwood

Publisher:Lauralee Sherwood

Chapter20: The Reproductive System

Section: Chapter Questions

Problem 1RE

See similar textbooks

Related questions

Q: Discuss the most common effects of cocaine abuse on emotions and perceptions.

A: Cocaine is a powerful stimulant drug that directly affects the brain's reward pathway. It increases…

Q: New nucleotides are added at an estimated rate of about 42-54 nucleotides per second in bacteria…

A: DNA replication is a biological process that occurs in all living organisms and is the basis for…

Q: Use the diagram below to answer the questions. hematocrits normal plasma leukocytes erythrocytes…

A: 1. Cancer of the white blood cells is called leukemia. Like other cancers, leukemia is associated…

Q: = Menu #1 Mol Bio Restriction An... X + Create All tools Edit Convert E-Sign Sign in Find text or…

A: 1. Total Size of the pMBB5 Plasmid in Base Pairs (bp)To determine the total size of the plasmid, we…

Q: how toxicology contributes to understanding the potential risks from toxic substances and aids in…

A: Toxicology is the scientific study of adverse effects that occur in living organisms due to…

Q: Logical sequence on each

A: Group 1:Mittyland spirit: This could refer to a fictional place or concept, possibly related to a…

Q: Total Parenteral Nutrition (TPN) is ordered for a 47 year old male patient is 6 ft 2 in tall and…

A: The total calories provided by the amino acids and the lipid emulsion can be calculated by adding…

Q: Please help me fix step #5

A: This reaction of C6H5C≡CH with mercuric sulfate, HgSO4, and water, H2O, is one of the more common…

Q: Question: Based on this scanning electron microscopy what is this bacteria’s morphology and…

A: Utilizing scanning electron microscopy, it has been shown that the bacteria possess a morphology…

Q: Please label each cell and function please

A: Labelling each part of the cell:1):-1.Golgi Bodies: Modify, sort, and package proteins and lipids…

Q: Hello, I would like to know anout Aspergillosis. What parts of the body can it affect? What are…

A: Aspergillosis is a fungal infection caused by Aspergillus, a common type of mold found in the…

Q: Make a claim or observation about dead zones and nitrogen input in the Chesapeake Bay that is…

A: Approach to solving the question:The correlation between dead zones and nitrogen input in Chesapeake…

Q: Overview of Transformation Protocol -Prepare competent bacteria for transformation: Treat starter…

A: Here is the sketch diagram of the Rainbow Transformation demo, depicting the results for all four…

Q: Describe the difference between tumor suppressor genes and proto oncogenes. In their normal cellular…

A: Tumor suppressor genes are a type of genes that protect a cell from one step on the path to cancer.…

Q: 1. What is the effect of a 5% chance of miscommunication (error) on the evolutionof cooperation:a)…

A: Key references: Van Dijk, E., Wilke, H. A. M., & Giebels, E. (2008). The effects of uncertainty…

Q: a) Describe the discovery of polymerase chain reaction (PCR), the components of the reaction and the…

A: The polymerase chain reaction (PCR) is a cornerstone of molecular biology, enabling the…

Q: Question 3 (Mandatory) (6 points) Use an example to illustrate how two different species concepts…

A: Let's take a look at the distinction between the Eastern Meadowlark (Sturnella magna) and the…

Q: Routes of Drug Administration are how drugs get into the body. Compare 4 different routes of drug…

A: Oral administration is the most common route of drug administration. It involves swallowing a drug…

Q: Are the number of species of chordates: 30 000, 40 000, 45 000 or 50 000?

A: The estimated number of species of chordates is approximately 50,000. This includes various groups…

Q: Hello, What curiocity can you tell me about Methicillin-resistant Staphylococcus aureus? Thank you…

A: Further readings:…

Q: What are some problems that scientists have when they investigate the effects of drugs on the brain?

A: The brain is an incredibly complex organ with billions of neurons and trillions of connections. This…

Q: Don't give AI answer otherwise I will give you downward Capillary zone electrophoresis of this…

A: Detailed explanation: The Capillary Zone Electrophoresis Results:HbS, HbA, HbF: This combination…

Q: Rank the caffeine content of a cup of brewed coffee, a cup of tea, a chocolate bar, a 12 ounce…

A: First, let's understand the average caffeine content in each of the items mentioned:A cup of brewed…

Q: Which of the following scientific investigations may use a compound light microscope? (check all…

A: A compound light microscope is a type of microscope that uses light and lenses to magnify images. It…

Q: What is moulting/ecdysis

A: Moulting, also known as ecdysis, is a biological process that occurs in certain animals,…

Q: Discuss the differences between motility in gram positive, gram negative and archaea flagellar…

A: In conclusion, despite the fact that both Gram-positive and Gram-negative bacteria use the proton…

Q: #6 and #7 please

Q: QUESTION 5 What non-specific defense component is directly responsible for the lysis of invading…

A: The question is asking about the non-specific defense component that is directly responsible for the…

Q: Match the item to its best description or use. Agarose 1. produces DNA fragments RFLP 2. important…

A: 1. Agarose - used to produce the actual gelAgarose is a polysaccharide that is derived from seaweed…

Q: a) Long interspersed elements (LINEs) are a type of b) Sequences of DNA assembled by identifying…

A: Long interspersed elements (LINEs) are a type of transposable elements. Transposable elements are…

Q: How many DNA fragments were produced by the enzyme Ava II?

A: Ava II is restriction enzyme that fits the DNA sequence 5'-AA^CGTT-3' and cleaves the DNA at the…

Q: Based on the first paper with the tables, fill out the second worksheet.

A: Mutation DescriptionRNA SequenceTranslated Protein SequenceTable for 3 DeletionsAUG UUC GAU CGA UCU…

Q: The arrows in the diagram below show how energy and matter flow between organisms. M

A: The diagram shows the flow of energy and matter between producers and consumers in an…

Q: If an indivua is a chronic smoker and is on warfarin, what would happen if they stopped smoking and…

A: Warfarin is an anticoagulant medication that is used to prevent blood clots. It works by inhibiting…

Q: Answer the following using Branch Diagrams using a set of completely made-up human characteristics…

A: Step 1:Step 2: Branched DiagramTo find the genotype ratio, just follow the line and multiply the…

A: A) 1-6; II-1 - 1) Aabb (I): Bu genotipda A dominant va b resessiv bo'lib, sariq patli to'ti va…

Q: Answer in step by step with explanation. Don't use Ai and chatgpt. Answer in all options

A: Important information:Resting membrane potential is established by the separation of charges across…

Q: Hello Can you please help me with the next question? (I would apreciate a short answer). What are…

A: Answer well explained above

Q: Explore the positive and negative impacts of Zomedica's TRUFORMA on individuals and groups from the…

A: Zomedica's TRUFORMA is a diagnostic platform designed to assist veterinarians in the detection of…

Q: QUESTION 13 Selective toxicity: Oa. harms the microbes without significantly harming the host. O b.…

A: Selective toxicity is a fundamental concept in pharmacology and microbiology. It refers to the…

Q: The Forbes sea star and common sea star are broadcast spawners that are known to hybridize, yet they…

A: Yes, Harper & Hart (2005) found evidence that gametes of the Forbes sea star (Asterias forbesi)…

Q: QUESTION 13 A cow recently fought off the tetanus bacterium. A serum of its antibodies was injected…

A: There are four types of immunity: natural passive immunity, artificial passive immunity, natural…

Q: The adaptive value is a measure of the evolutionary impacts of a behaviour, i.e. the ultimate…

A: The behaviour of a horse gently swishing its tail and occasionally stomping its feet is a response…

Q: Applay all options with explanation. Don't use Ai and chatgpt

A: The TRUE statements are:During oxidative phosphorylation, the proton motive force created by the…

Q: Compared to other types of muscle cells, cardiomyocytes have a lot more: A) Calcium ions B)…

A: Cardiomyocytes, or heart muscle cells, have a higher number of mitochondria than other muscle cells…

Q: My reaction to how vital electrolytes are and why sodium is important (focus on sodium more)

A: Electrolytes play a critical role in maintaining balance and proper functioning within the body,…

Q: Why do you think scientists were initially skeptical that a bacterium like H pylori, rather than…

A: Approach to Solving the Question:Identify the Core Issue: Understand why scientists would doubt a…

Q: Don't upload image. Answer in step by step with explanation. Don't use Ai and chatgpt

A: Step 1. Relative Water Level: 45 Explanation: At this level, the mouse population cannot sustain…

Q: If a person is on both clopdifogrela and omperzaole, which are they more likely to experience,…

A: When considering the interaction of clopidogrel and omeprazole, it's important to understand how…

Q: 5' CCTAGCTTTCCGATAAAGCTATTCAAGT 3' The Alu1 enzyme cuts at this sequence: 5' AGCT 3' sequence. How…

A: To determine how many DNA fragments result from cutting the given DNA sequence with the AluI enzyme,…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

How many Barr bodies will be in a body cell of an XY male?

AI-Generated Solution

AI-generated content may present inaccurate or offensive content that does not represent bartleby’s views.

Unlock instant AI solutions

Tap the button
to generate a solution

Click the button to generate
a solution

SEE SOLUTION

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

How many eggs are produced as a result of one meiotic series of cell divisions? one two three four
What might be a disadvantage to temperature-dependent sex determination?
What is the difference between gamete intrafallopian transfer (GIFT) and intracytoplasmic sperm injection (ICSI)?
Mutations Can Uncouple Chromosomal Sex from Phenotypic Sex Give an example of a situation in which genetic sex, gonadal sex, and phenotypic sex do not coincide. Explain why they do not coincide.
Identify some differences between meiosis in men and women.
Sperm and ova are similar in terms of ________. size quantity produced per year chromosome number flagellar motility
Cleavage produces daughter cells called ________. trophoblasts blastocysts morulae blastomeres
Equalizing the Expression of X Chromosome Genes in Males and Females How many Barr bodies would the following individuals have? a. normal male b. normal female c. Klinefelter male d. Turner female
Watch this series of videos (http://openstaxcollege.org/l/oocyte) to look at the movement of the oocyte through the ovary. The cilia in the uterine tube promote movement of the oocyte. What would likely occur if the cilia were paralyzed at the time of ovulation?
A spermatogonial cell undergoes mitosis before entering the meiotic cell cycle en route to the production of sperm. However, during mitosis the cytoplasm fails to divide, and only one daughter cell is produced. A resultant sperm eventually fertilizes a normal ovum. What is the chromosomal complement of the embryo?
Briefly explain why mature gametes carry only one set of chromosomes.
A cell (2n = 4) has undergone cell division. Daughter cells have the following chromosome content. Has this cell undergone mitosis, meiosis I, or meiosis II?