Handwritten. PART A. Write the structure of the following peptides in a bond paper and upload as pdf file. Expanded structure. Use red ink for peptide bond. [For your reference download all the amino acids with the three and single letter symbol] (possible points 9) a) threonyl leucyl asparagyl alanine b) glycyl tyrosyl histidyl glutamic acid c) phenylalanyl valyl arginyl seryl tryptophan
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: The coupled system of reactions for measuring pyruvate kinase (PK) activity involves two sequential…
Q: 9. a. Which class of enzymes do poisonous snakes use to rock your world when they bite their prey?…
A: The objective of the question is to identify the class of enzymes used by poisonous snakes when they…
Q: 1. What is the isoelectric point of tyrosine? Draw out the different structures of tyrosine at each…
A: **Since you have posted multiple questions, we will provide the solution only to the first question…
Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R2 as…
A: Major elements of biological membranes are phospholipids, which include phosphatidylcholine and its…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: The active sites can also refer to enzymes, so in this question we are talking about the enzymes…
Q: In no more than two sentences each describe electroporation
A: There are several methods or techniques that allow us to introduce foreign DNA into the host cell,…
Q: Sketch out the binding site of Hemoglobin with oxygen bound . ( You can abstract the Heme ring out…
A: Hemoglobin is a metalloprotein that contains iron. Hemoglobin is present in the red blood corpuscles…
Q: 2. The precise biochemical mechanisms underlying the rapid shutdown of glycolysis in skeletal muscle…
A: Detailed explanation:In anaerobic conditions, pyruvate is often converted into lactate or ethanol,…
Q: Can you help with q3 please, thank you.
A: The intermolecular interactions for the given active site of RNA is listed below . Explanation:Step…
Q: (b) ☐ The exergonic reactions catalyzed by isocitrate dehydrogenase (ICDH) and α- ketoglutarate…
A: Isocitrate Dehydrogenase (ICDH): Function: ICDH plays a crucial role in the TCA cycle by catalyzing…
Q: 5. Trehalose, a disaccharide produced in fungi, has the following structure: CH₂OH H OH H H H H OH H…
A: a. α-D-glucopyranosyl-(1→1)-α-D-glucopyranoside b. Trehalose is not a reducing sugar.Explanation:…
Q: ALL THAT APPLY
A:
Q: Which feature of an enzyme, distinct from non-enzyme proteins, relates specifically to their…
A: The question is asking us to identify the unique feature of enzymes that is directly related to…
Q: Now consider three sugars-glucose, glucuronic acid, and N-acetylglucosamine. Use shorthand (e.g.,…
A: The objective of the question is to identify the correct shorthand notation for the trisaccharide…
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: Draw the structure of the isoprenoid biogenic precursor of the terpenes and show the steps in the…
A: Terpenes are unsaturated hydrocarbons produced by conifers (plants). Their general chemical formula…
Q: What is(are) the only active site(s) not used in the second round of fatty acid synthase? Select all…
A: Here's a breakdown of why these are not used in the second round: Acetyl-CoA ACP Transacylase: This…
Q: The RNA sequence below encodes a very short protein: 5’ ACCGUACGACCAUGUCCCACUAUCCCUAGGCGAUC 3’…
A: Start and Stop Codons:In the genetic code, certain codons have specific roles. The codon "AUG"…
Q: 48. A 58-year-old woman comes to the office because of a 1-month history of fatigue, fever,…
A: The objective of the question is to identify the cell type that is most likely being directly…
Q: With the advent of photosynthesis, the amount of oxygen in the atmosphere has varied over the eons…
A: Approach to solving the question:Detailed explanation:Examples:ANSWER IS 12 ML H20 Key references:…
Q: Genetics Q3
A: The question is asking us to determine the percentage of Adenine (A), Guanine (G), and Cytosine (C)…
Q: 9. Which reactions in Model 2 are hydrolysis reactions? 10. Write the soap formed in the following…
A: hydrolysis is an chemical reaction , in which a molecule of water is breaks into One or more…
Q: An a helix would be destabilized MOST by ○ a glycine residue adopting alpha-helical backbone…
A: The stability of an alpha-helix is influenced by various factors including the propensity of amino…
Q: Question 9
A: The question is asking us to identify the enzyme that is responsible for separating DNA strands…
Q: What is the major organic product obtained from the following reaction? CH3 2 4 3 1 (CH3)2C=CH2 HF…
A: Step 1:
Q: Label each Amine (A–D) in Table 1 as primary, secondary, or tertiary. Which classes of amines –…
A: Good evening,Hope this helps, Thank you!Explanation:Approach to solving the question: Detailed…
Q: The storage polysaccharide starch is a mixture of the molecules amylose (an unbranched polymer of…
A: Imagine a giant rope made up of multiple strands (like amylopectin). If you wanted to dismantle that…
Q: Throughout the electron transport chain many reactions occur. What happens to NADH eventually? ONADH…
A: In terms of hydrogen atom transfer , Oxidation is defined as the reaction in which a substance or a…
Q: List all of the regulatory enzymes from both Glycolysis and Gluconeogenesis, and under each, list…
A: Glycolysis:Hexokinase:(-) Inhibitors: Glucose-6-phosphate (product inhibition)(+) Activators: None…
Q: ANSWER A AND B PLS
A: To determine the Vmax and Km in the absence ofinhibitors, we can use the Michaelis-Menten equation,…
Q: Experiment Mouse injected with type S Mouse injected with type R Lived or Died Die Live Mouse…
A: In 1928, Frederich Griffith undertook the bacterial transformation experiment where he injected mice…
Q: 13. The structures of sphingosine and choline are given below. Draw the condensed structure and…
A: Sphingolipids has sphingosine as its platform molecule. Onto this sphingosine, a head group and a…
Q: In the situations described below, what is the free energy change if 1 mole of Na+ is transported…
A: The objective of the question is to calculate the free energy change (ΔG) when 1 mole of Na+ ions is…
Q: Predict the product of the following organic reaction: CH₂ CH Ni + 3 H₂ P CH2 Specifically, in the…
A:
Q: 3. In your textbook the termi- nal enzyme catalyzing the ter- minal step of glycolysis is known as…
A: Approach to solving the question: This question is divided into two parts:(a) The first part…
Q: STEM Workplace Practices Q6
A: The objective of the question is to determine whether the optimization of an analytical method is…
Q: If someone's pH increases above 7.8, they die. How much would the % buffer have to shift from normal…
A: The usual pH range for blood is 7.35 to 7.45. The body's buffering systems, such as the phosphate…
Q: Why is 1, 2, 3, 4-tetraphenylcylopentadienone a dark purple color while most other organic compounds…
A: Option a: This option is incorrect because, 1, 2, 3, 4 - tetraphenylcylopentadienone is not a…
Q: Parts of the mechanism for lysozyme are shown below. The catalytic lysozyme residue side chains can…
A: Lysozymes cleave the glycosidic bond between N-acetylmuramic acid (Mur2Ac) and N-acetylglucosamine…
Q: what is balanced chemical equation for the oxidation of benzoin to benzil using sodium hypochlorite
A: ### Reactants1. **Benzoin**: This is an organic compound with two aromatic rings bonded together…
Q: In the same kinetics experiment above without the inhibitor, what is the fraction of occupied enzyme…
A: Michaelis Menton equationFor a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton…
Q: A gene encoding a miRNA was mutated so that it forms a perfect complement to its target mRNA. This…
A: MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play a pivotal role in the regulation…
Q: Absorbance A calibration curve for the absorbance of an unknown is shown below. What would be the…
A: A calibration curve is plotted to determine how the absorbance of a solution changes as per the…
Q: Find the structure of insulin online.Draw the tripeptide at the beginning of the Chain A and the…
A: Insulin is a peptide hormone composed of two polypeptide chains, usually referred to as Chain A and…
Q: The most important contribution to the stability of a protein's conformation appears to be the: ○ A)…
A: The most important contribution to the stability of a protein's conformation appears to be the:…
Q: 8. Draw the product(s) for the following biosynthetic reactions catalyzed by enzyme listed below the…
A: 1.2.3.4.5.
Q: How u make it I want excel file or tell me how to make excel file now. U answered naa?? I will make…
A: The Lineweaver-Burk plot, also known as a double reciprocal plot, is a graphical representation of…
Q: (Biochemsitry, Topics: Glycolysis and Citric Acid Cycle) - How many ATP are formed from the…
A: The complete oxidation of fructose in the liver involves a series of biochemical reactions that…
Q: Question 5
A: The question is asking whether a mouse would die if it was injected with a mixture of heat-treated S…
Q: 4. The interaction of Vitamin D3 with lipid membranes may be studied using different techniques. One…
A: A class of fat-soluble secosteroids is called vitamin D3 .Vitamin D3 is a kind of vitamin D that is…
![Handwritten.
PART A.
Write the structure of the following peptides in a bond paper and upload as pdf file.
Expanded structure.
Use red ink for peptide bond. [For your reference download all the amino acids with the three and single letter symbol]
(possible points 9)
a) threonyl leucyl asparagyl alanine
b) glycyl tyrosyl histidyl glutamic acid
c) phenylalanyl valyl arginyl seryl tryptophan](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2F1133f542-61fa-4db6-979e-63818bbc57bc%2Fb20b29ba-063f-4667-af65-2ecf7899c847%2Fenzsvv_processed.jpeg&w=3840&q=75)
Step by step
Solved in 2 steps with 1 images
- Description Please draw the structure of the 19 L-a-amino acids and proline in any form, as you prefer. You may want to use a letter-size sheet or larger, it's up to you. Guiding principle: You want to understand the differences among amino acids. Although you may want to only draw the R-group it's preferable to draw it along with the rest of the molecule (i.e., the Ca, the amino group and the carboxyl group). Here are some examples (your drawings should not limited to the following styles): H₂C NH₂ OH shutterstock.com-222977980 Alanine H H Proline OH %%% lysine a alamy stock photo Tryptophan HN NH₂ shutterstock.com-1819000134 QH COOH H₂N-C- H CH ₂ Phenylalanine H₂N NH dreamstime.com arginine NH₂ OHA. Write the structure of the following peptide at pH 5.0 and calculate its net charge at this pH. Asp-His-Tyr-Arg-Lys-Leu-Thr-Gln. Based on the pKa value of the ionizable groups. B. A polypeptide consisting only of L-glutamate residues (poly-L-glutamate) may have a random coil or helical structure depending on pH. Explain this behavior by indicating at what pH values the helical structure will be favored.Consider each dipeptide. Part: 0 / 4 Part 1 of 4 HO || H H H3N C-C-N-C-COO Identify the amino acid(s) present in this structure. Check all that apply. U U U glycine cysteine valine alanine Ophenylalanine ☐ U U asparagine tyrosine threonine leucine glutamine serine ☐ isoleucine methionine None of the above X
- E. PROTEIN PRIMARY STRUCTURE ELUCIDATION. 1. Determine the primary structure of the protein described below. Write the final sequence using the corresponding three-letter code for each amino acid. Example: M-F-Y-R should be written as Met-Phe-Tyr-Arg Treatment with cyanogen bromide and sequencing yields the following peptide fragments: o D-M o R-A-Y-G-N o L-F-M Chymotrypsin digestion and sequencing yields the following peptide fragments: o G-N D-M-L-F o M-R-A-Y o oDon't use Ai and chatgpt. Answer in step by step with explanation.Consider each dipeptide. Part: 0/4 Part 1 of 4 N—C—COO བཙས་མའི་ཡའི་ཡ[ཡ་སྦ་ Identify the amino acid(s) present in this structure. Check all that apply. ☐ leucine ☐ phenylalanine ☐ tyrosine ☐ valine ☐ methionine ☐ glutamine ☐ alanine ☐ threonine ☐ serine ☐ cysteine ☐ glycine ☐ isoleucine ☐ asparagine
- PRACTICE NAMING. Identify the number of amino acids, number of peptide bonds, and name the peptide. i.e. Ala-Cys • Dipeptide • 1 peptide bond • Alanylcysteine Cys-tyr-phe-gln-asn-cys-pro-arg-glyProtein-4YU4 is given, choose a part of it (containing at least 30 amino acid residues), find the amino acid sequence (sequence in it), identify what functional groups the amino acid substitutes contain (carboxyl group and 2-position the Nitro group will form amide bonds, forming the covalent basic structure of the protein). What different interactions can occur between these functional groups? How will it relate to the spatial structure of the protein?Asp-Gly-Lys-Glu-Ile-Phe Draw its full chemical structure as it would exist at pH = 7.0. Draw an arrow pointing to each peptide bond. Identify the net charge of the peptide and briefly explain how you arrived at this answer.