Draw the major organic product obtained from the following sequence of reactions (assume that mixtures of ortho and para disubstituted compounds can be separated; continue the synthesis with either one)? (Draw your major product and upload the drawing using the submission link.) CH3 HNO3 H₂SO4 K2Cr2O7 H₂SO4 H2, Ni NaNO2, H3O+ KI
Q: Calculate and plot the vibrational partition function of CSe2 between 500K and 1000K (with a step of…
A: Final AnswerNow, let's plot the total partition function against temperature.Explanation:Step 1…
Q: Calculate the K of A given K₁ = HA(aq) + H2O(l) = H3O+ (aq) + A¯¯(aq) K = 5.90×108
A: 1) Kb of A- = 1.69 x 10-7 2) a) Ka of weak monoprotic acid, HA = 2.3 x 10-5 b) Percent ionization of…
Q: 14. What is the major organic product obtained from the following reaction? CH3 CH3 Br Br &&& Br2…
A:
Q: Tt O 8. What are the driving forces that promotes tertiary -3D and quaternary -4D structure…
A: Proteins are the biological macromolecules. They show great diversity in their structure and…
Q: What is the major function of cholesterol esters? O Make cholesterol more hydrophobic so they can be…
A: Cholesterol esters are chemical compounds formed by the esterification of cholesterol molecules with…
Q: What is the chemistry principle behind when (treatment: heavy cream, evaporated milk, and NFDM) is…
A: The behavior of dairy products beneath diverse conditions, including temperature variations and…
Q: 8 From the Hill Plot below, the of the first binding event for the receptor-ligand system under…
A: The hill plot is a graph drawn based on the Hill equation given below.This identifies with the…
Q: 5'-AATGCCTCAGCCGATCTGCCTCGAGTCAATCGA TGCTGGTAACTTGGGGTATAAAGCTTACCCATGGTATCGTAG…
A: PCR is a lab technique used for amplification of target DNA sequence by using a thermostable DNA…
Q: A particular reaction has a ΔG‡ of 37.0 kJ mol-1. In the presence of an enzyme, the same reaction…
A: The objective of this question is to calculate the change in Gibbs free energy of activation (ΔΔG‡)…
Q: STEM Workplace Practices Q3
A: The objective of the question is to understand the purpose of release-testing in the context of…
Q: When 10 micrograms of an enzyme with a molecular mass of 80,000 Daultons (grams/mol) is added to a…
A: Before going into the calculations for finding the turnover number (kcat), we need to convert…
Q: What is the concentration in ppm of Sulphur in a water supply if there are 0.002mL of Sulphur in…
A: Step 1:We need to use the conversion 1ppm= 0.001mL/LBased on the given,Since we have 0.002mL/L…
Q: Initiation of translation in E. coli requires: Question 26 options:…
A: Initiation of translation in E. coli requires several components, including:1. mRNA: The messenger…
Q: 8. Draw the product(s) for the following biosynthetic reactions catalyzed by enzyme listed below the…
A: 1.2.3.4.5.
Q: 8. Amino acids typically consist of a central carbon atom. Attached to this central carbon are an…
A: If the a-hydrogens in the a-alpha helix are replaced by a second side chain (a second R group), it…
Q: Knowing that liquid liquid phase separation will occur when the change of gibbs free energy of the…
A: Inducing Liquid-Liquid Phase Separation (LLPS) in Cells-Liquid-liquid phase separation (LLPS) relies…
Q: Briefly explain....Represent the reactions when Phosphatidylethanolamine was treated with; (I)…
A: ● Phosphatidylethanolamine is a type of phospholipid found in cell membranes.● It consists of a…
Q: MSA: 1. Explain the incubation conditions 2. Explain the reagents being added 3. Explain the…
A: “Since you have posted a question with multiple sub parts, we will provide the solution only to the…
Q: The activity of ________ will result in an increasedpositive charge on the histone.…
A: Answer: b. Histone deacetylaseExplanation:• Histone acetyltransferases (HATs): These enzymes add an…
Q: Which of the following statements regarding polynucleotides is true? a) A double stranded DNA forms…
A: The correct answer is: a) A double-stranded DNA forms a right-handed helix, where both strands run…
Q: (c) The tube and cylinder diagram to the right illus- trates schematically the potassium channel…
A: answers are given below.Explanation:c) the positioning of Tyr62 and Thr74 on the Alpha helix is…
Q: COOM HO quercetin p-hydroxybenzoic acid A B Molecule A: 162 g/mol Molecule B: 1520 g/mol Molecule C:…
A: Size exclusion chromatography is the technique of separating of analyte molecules based in their…
Q: group)? 9. Probability of finding prolines in ẞ-turns are much more in comparison to a-helices or…
A: The preference for proline residues in β-turns compared to α-helices or β-sheets is primarily due to…
Q: Draw the structure of phosphatidylcholine at pH 7 with the moiety on R₁ as 14:0 (C14) and R2 as…
A: Major elements of biological membranes are phospholipids, which include phosphatidylcholine and its…
Q: 11. Describe the functions of the following steroid hormones. a. Androgens b. Glucocorticoids c.…
A: The question is asking for a description of the functions of three types of steroid hormones:…
Q: While fatty acids longer than 20 carbons are rarely found in foods, lignoceric acid (24:0) is found…
A: Liganoceric acid (24:0) metabolism entails a number of crucial processes that lead to the production…
Q: Genomic imprinting refers to the inheritance of: Question 16 options: Gamete…
A: The correct answer is:Gamete specific DNA methylating marks during meiosis.Genomic imprinting refers…
Q: 9. Which reactions in Model 2 are hydrolysis reactions? 10. Write the soap formed in the following…
A: hydrolysis is an chemical reaction , in which a molecule of water is breaks into One or more…
Q: a) Based on the data shown in the image, what are the Km and Vmax for the enzyme with L-DOPA and…
A: Enzymes catalyse biochemical reactions by lowering their activation energy. Enzymes bind to their…
Q: What is the final reaction in the final round of fatty acid synthase? Acetyl-CoA ACP Transacylase…
A: The question is asking about the final reaction in the process of fatty acid synthesis. Fatty acid…
Q: Natural products are the future of drug discovery. Discuss this statement giving three reasons why…
A: Reasons why natural products are a good source of novel drugs: Chemical Diversity: Natural products…
Q: A gene encoding a miRNA was mutated so that it forms a perfect complement to its target mRNA. This…
A: MicroRNAs (miRNAs) are a class of small, non-coding RNAs that play a pivotal role in the regulation…
Q: Which of the following factors does not pay for the generation of NADH and ATP during steps 6 and 7…
A: The factor that does not directly contribute to the generation of NADH and ATP during steps 6 and 7…
Q: using sample prep aka the protocol use it to fill in the tables
A: Explanation: Lysozyme (mL): The amount of lysozyme diluted and added to each conical tube. The…
Q: The peptide below is placed into a buffer with a pH = 1.73 H3N-CH- CH2 NH—CH—C H3C-CH NH—CH—C NH—CH-…
A: Electrophoresis means the migration of a charged particle under the influence of an applied electric…
Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5' Table 22.4 mRNA…
A: The process of protein synthesis is also known as translation. The process of translation is…
Q: Which of the following amino acids have a role in the urea cycle (check all that apply)?…
A: The objective of the question is to identify the amino acids that play a role in the urea cycle. The…
Q: If the anticodon of an alanyl-tRNA is IGC (inosine-guanine-cytosine), to which of the following…
A: In order to answer this question, we must be familiar with Wobble hypothesis. We know that the mRNA…
Q: Calculate the percent error for pipette P1000.
A: The pipette is designed to dispense a specific volume of liquid, in this case 1000 microliters (uL).…
Q: ẞ-Calendic acid is an omega-6, conjugated fatty acid that is the all-trans isomer of a-calendic…
A: Polyunsaturated fatty acids (PUFA) are fatty acids with more than one double bond. Complete…
Q: raw the reaction between sphingosine and arachidonic acid. Draw out the full structures.
A: Sphigosine is the platform molecule of sphingolipids. Arachidonic acid is a 20 carbon fatty acid…
Q: Biological Macromolecules Identifying molecules that could be in a cell membrane te for advanced…
A: Cell membranes are mostly composed of phospholipids. An important characteristic of phospholipids is…
Q: Melting Temperature (Tm) of a dsDNA molecule is the temperature at which a 100% of…
A: The correct answer is:c. 50% of the dsDNA exists in a single-stranded (denatured) form.…
Q: The following table provides data on three popular protein supplements. (Figures shown correspond to…
A: Let the number of servings of designer whey be 'x' and the number of servings of muscle milk be…
Q: Estimate the viscosith of 1.0 vol % agarose gel solution if it took 58 minutes for 1500 base pairs…
A: In order to solve this problem, we need to first calculate electrophoretic mobility () during the…
Q: The cytochromes are heme-containing proteins that function as electron carriers in the mitochondria.…
A: The objective of the question is to calculate the difference in the reduction potential (ΔE°') and…
Q: Which of the following statements is most accurate ? All statements are accurate All prescribed…
A: The objective of the question is to identify the most accurate statement among the given options…
Q: QUESTION 5 Carbohydrates supply which element for the construction of other biomolecules? carbon…
A: Carbohydrates supply the element carbon for the construction of other biomolecules. Carbon is a…
Q: Describe in detail what is meant by a "self- restricted/ self-tolerant" T cell. A diagram is…
A: Approach to solving the question:
Q: Limonene is a isoprenoid compound responsible for the characteristic odor of lemons. Propose a…
A: Step 1: Step 2: Step 3: Step 4:
Step by step
Solved in 2 steps with 1 images
- Please don't provide handwriting solutionWrite the balanced reaction catalyzed by phophoenolpyruvate carboxylase (P PC). Remember to add any cofactors, and to draw the structure formulas (a line-bond representation is fine) for the main substrate and product of the reaction.Predict the products of this organic reaction: CH, ọ CHICH CHO CHỊ CHI CHI + NaOH Specifically, in the drawing area below draw the structure of the product, or products, of this reaction. (If there's more than one product, draw them in any arrangement you like, so long as they aren't touching.) If there aren't any products because this reaction won't happen, check the No reaction box under the drawing area. No reaction Click anywhere to draw the first atom of your structure. C X Ĉ S
- For the following monosaccharide, draw the products formed when treated with each reagent. H. HO H H OH HO H H OH Part 1 of 2 CH₂OH H₂ in the presence of a Pd catalyst. Modify the Fischer projection of the monosaccharide to represent the product. H HO -H H -OH HO -H H -OH CH₂OH Part 2 of 2 Benedict's reagent. Modify the Fischer projection of the monosaccharide to represent the product. HO H H -OH HO H H -OH CH₂OH Q:Associate the biochemical reaction in TSI agar to certain genera or species. Reaction Possible Organism(s) K/K K/A K/A, H2S* A/A A/A A/A, H2S*For the following monosaccharide, draw the products formed when treated with each reagent. H H -OH HO H HO H H― -OH CH₂OH Part 1 of 2 H2 in the presence of a Pd catalyst. Modify the Fischer projection of the monosaccharide to represent the product. H H -ОН HO H HO H H -OH CH₂OH Part 2 of 2 Benedict's reagent. Modify the Fischer projection of the monosaccharide to represent the product. H H -OH HO -Н HO H H -OH CH₂OH ☐ : G ☐ E ☐: ☑ P G
- Draw the major organic product obtained form the following sequence of reactions (assume that mixtures of ortho and para disubstituted compounds can be separated; continue the synthesis with either one)? NO₂ Br, FeBr3 H2, Ni NaNO2, H3O+ HBF4Draw the major organic product for the following reaction. 1. LiAlH ཝ་རི་-w;"", - CH3-C C-CH 2.Please answer this correctly according to the requirements .show neat and clean work .
- Create a ONE page, formal summary, including APA Formatted in-text citations, of the enzyme amalyze and how it is used in the meat processing industry (Address all guiding questions below in your summary). Note, references can be the second page of the assignment. Include the questions in ur answer Which enzyme is used in the industry (if more than one enzyme is included, you can choose one of the enzymes) Describe the molecular structure of the enzyme (how many amino acids; discuss different levels of protein structure-secondary, tertiary, quaternary, key structural components/amino acids in active site) Describe how the enzyme works in the industry and why it is a key component for this industry. What specific reaction(s) are being catalyzed? What types of bonds are being broken?Predict the missing reactant of this biochemical reaction: X + Pi P-O + H₂O That is, in the drawing area below, draw the chemical structure of the reactant molecule X. Note for advanced students: you can assume any necessary small-molecule reactants, like water, are available. Click and drag to start drawing a structure. X :0 ŚThe biosynthesis of vitamin D₂ is a two-step reaction, requiring two types of concerted pericyclic reactions. Draw in the arrows for each step and identify the structure of precalciferol. If an electrocyclic reaction is required, identify if it occurs through a conrotatory or disrotatory reaction. HO H H ergosterol hv precalciferol Cast HO ergocalciferol