38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table. DNA DoubleG TAAHelixCMRNAACACCTranscribedTRNAAnticodonAmino AcidProSequenceAmino AcidAbbreviationsA, Second letterKey:Ala = Alanine (A)Arg Arginine (R)Asn = Asparagine (N)Asp Aspartate (D)Cys Cysteine (C)Gin = Glutamine (Q)Glu = Giutamate (E)Gly = Glycine (G)His = Histidine (H)lle Isoloucine (I)Leu = Leucine (L)Lys Lysine (K)Met Methionine (M)Phe = Phenylalanine (FPro Proline (P)Ser = Serine (S)Thr = Threonine (T)Trp = Tryptopman (W)Tyr Tyrosine (Y)UGU]UGC CysUGA STOPUGG TrpUUUUCUUCCUAC TyrUAA STOPUAG STOPUUC PheSerUCAUGUUALeuUUGCUUCUCCCUCCCAUCAC}CGUCCHisLeuProArgCUACUGCCACCGCAACGACAG GinGGAUUACUACCACAAGUAGCAAUSerAUC leAUAAAC AsnThrAAAAGAAUG MetACGAAG LysAGG ArgGUUGCUGCCGAUGGTGGCGlyGUCGAC AspValAlaGCAGCGGUAGAAGGAGAG GluGGGGUGVal -Valine (V)Third letterअ० ५०२० ०First letter

DNA has sense and antisense sequence, sense codons have the same bases as that of mRNA except that…

Answered: DNA Double А A Helix C T C C MRNA A C C…

DNA Double А A Helix C T C C MRNA A C C C Transcribed TRNA A Anticodon Amino Acid Pro Sequence Amino Acid N Abbreviations

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: 36. How many different amino acids would be found in a polypeptide made from translation of an RNA…

A: The transcription is the process in which the mRNA copied information from DNA for protein…

Q: Help me figure out how I should interpret and read these graphs. We are looking to see whether the…

A: The regulation of RNA splicing is a complex process that involves the interaction of multiple…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…

A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…

Q: Wild-type Mutant 1 Mutant 2 Mutant 3 Stop silent DNA 3 CTT 5 5 3 5 Val missense 3CTC 5 5 GAG 3 mRNA…

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: 19. For this question, you will need to use the table for the genetic codes provided on the…

A: From DNA , mRNA is formed and use DNA strand as a template. Produced mRNA goes to cytosol and…

Q: 6.c. Mutated DNA Template Strand #3: 3'-TACTGAC TGACTATC-5' Complementary DNA sequence: mRNA…

A: The mutation is the change in the base sequence of the DNA nucleotide sequence or a gene. The…

Q: None

A: Thes images is only for reference purposes

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: The genetic code is both universal and degenerate. Explain how these aspects are an advantage, but…

A: Proteins are made up of amino acids encoded by codons. Each codon consist of three nucleotide which…

Q: What is the total size of the mature i.e. fully processed mRNA in nucleotides?

A: Primary transcript of mRNA contains exons as well as introns. But After the process of splicing…

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction : The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: Briefly describe two important functions of the 5’ methyl guanine cap on eukaryotic mRNAs.

A: In eukaryotes, the nascent RNA that is synthesized by RNA polymerase II is called hnRNA…

Q: If the code were a sextuplet (containing of six nucleotides), would the reading frame be restored by…

A: A frameshift mutation is induced by adding or deleting several nucleotides in a DNA sequence that is…

Q: 14.18) Write the three-letter abbreviations for the amino acid residues, in order from N-terminus to…

A: It is important to know how DNA and RNA work together to make proteins. In transcription, DNA helps…

Q: The following polynucleotide was synthesized and used as a template forpeptide synthesis in a…

A: The consecutive three nucleotides together form one codon. Each codon encodes for a particular amino…

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…

Q: in the human beta-globin, two introns are spliced out in order to produce the mature mRN

A: The gene regulation can be exercised at different levels where DNA can be packed tightly or loosely…

Q: Consider the following gene with their respective introns and exons 5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: A genetic code is defined as the blueprint for the synthesis of proteins. Normally, three nucleotide…

Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.

A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…

Q: Sanger product of the sequencing of a template DNA is presented below. It is the polymorphic peptide…

A: Given : Ser-Gly-Lys-Glu-Gly-Lys-Lys 1 amino acid : 3 codons 7 amino acids : 7×3= 21 codons

Q: termini). What type of mutation is each? 6.a. Mutated DNA Template Strand #1: 3'-TACTGTC TGACGAT…

A: DNA It is a double helix structure that constitutes two polynucleotide chains wound around each…

Q: 17. Complete the following Central Dogma Grid Puzzles: First determine which DNA strand is the…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: 2. H. Gobind Khorana deciphered the genetic code by (1) chemically synthesizing DNA molecules of…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Question

38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table.

DNA Double
G T
A
A
Helix
C
MRNA
A
C
A
C
C
Transcribed
TRNA
Anticodon
Amino Acid
Pro
Sequence
Amino Acid
Abbreviations
A,

Second letter
Key:
Ala = Alanine (A)
Arg Arginine (R)
Asn = Asparagine (N)
Asp Aspartate (D)
Cys Cysteine (C)
Gin = Glutamine (Q)
Glu = Giutamate (E)
Gly = Glycine (G)
His = Histidine (H)
lle Isoloucine (I)
Leu = Leucine (L)
Lys Lysine (K)
Met Methionine (M)
Phe = Phenylalanine (F
Pro Proline (P)
Ser = Serine (S)
Thr = Threonine (T)
Trp = Tryptopman (W)
Tyr Tyrosine (Y)
UGU]
UGC Cys
UGA STOP
UGG Trp
UUU
UCU
UCC
UAC Tyr
UAA STOP
UAG STOP
UUC Phe
Ser
UCA
UG
UUA
Leu
UUG
CUU
CUC
CCU
CC
CAU
CAC
}
CGU
CC
His
Leu
Pro
Arg
CUA
CUG
CCA
CCG
CAA
CGA
CAG Gin
GG
AUU
ACU
ACC
ACA
AGU
AGC
AAU
Ser
AUC le
AUA
AAC Asn
Thr
AAA
AGA
AUG Met
ACG
AAG Lys
AGG Arg
GUU
GCU
GCC
GAU
GGT
GGC
Gly
GUC
GAC Asp
Val
Ala
GCA
GCG
GUA
GAA
GGA
GAG Glu
GGG
GUG
Val -
Valine (V)
Third letter
अ० ५०
२० ०
First letter

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

b. Now do this AGAIN assuming that the DNA and RNA templates are read right to left. DNA strand C DNA strand T G A MRNA codon C|A U TRNA anticodon G A polypeptide TRP
For the ovalbumin gene shown, indicate the locations of the following: (a) transcription start site, (b) template strand, and (c) promoter.
41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?
Define Reading frame as they apply to the genetic code
The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber material (picture). It corresponds to a complete transcriptional unit without introns. Use the Genetic Code to predict the primary sequence of the polypeptide encoded by this preserved DNA. (Show relevant molecular intermediates, and provide detailed and appropriate labels)
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
Identify each tertiary structure shown below. Draw the chemical mechanism for base-catalyzed RNA hydrolysis.
Sequence most commonly found at the boundary between exon-intron boundaries is at the 5' end and at the 3' end Question 33 options: G/GU; AG/G AG/G; G/GU A/GG; GG/U All of the above
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mu- tants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations- that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify MRNA sequences that could encode each of these amino acid sequences and deter- mine whether your codon assignments are consistent with the genetic code. Wild-type ... Lys-Ser-Pro-Ser-Leu-Asn-Ala. .. Double mutant - ..…
34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand