38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table. DNA DoubleG TAAHelixCMRNAACACCTranscribedTRNAAnticodonAmino AcidProSequenceAmino AcidAbbreviationsA, Second letterKey:Ala = Alanine (A)Arg Arginine (R)Asn = Asparagine (N)Asp Aspartate (D)Cys Cysteine (C)Gin = Glutamine (Q)Glu = Giutamate (E)Gly = Glycine (G)His = Histidine (H)lle Isoloucine (I)Leu = Leucine (L)Lys Lysine (K)Met Methionine (M)Phe = Phenylalanine (FPro Proline (P)Ser = Serine (S)Thr = Threonine (T)Trp = Tryptopman (W)Tyr Tyrosine (Y)UGU]UGC CysUGA STOPUGG TrpUUUUCUUCCUAC TyrUAA STOPUAG STOPUUC PheSerUCAUGUUALeuUUGCUUCUCCCUCCCAUCAC}CGUCCHisLeuProArgCUACUGCCACCGCAACGACAG GinGGAUUACUACCACAAGUAGCAAUSerAUC leAUAAAC AsnThrAAAAGAAUG MetACGAAG LysAGG ArgGUUGCUGCCGAUGGTGGCGlyGUCGAC AspValAlaGCAGCGGUAGAAGGAGAG GluGGGGUGVal -Valine (V)Third letterअ० ५०२० ०First letter

DNA has sense and antisense sequence, sense codons have the same bases as that of mRNA except that…

Answered: DNA Double А A Helix C T C C MRNA A C C…

DNA Double А A Helix C T C C MRNA A C C C Transcribed TRNA A Anticodon Amino Acid Pro Sequence Amino Acid N Abbreviations

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: Eukaryotic transcription requires a "cap" at one end and a "tail" at the other end of each mRNA…

A: Eukaryotic transcription is the process that eukaryotic cells use to copy genetic material through…

Q: Explain the term polycistronic mRNA.

A: An m RNA that can encode for many proteins is known as polycistronic m RNA.. This m RNA is present…

Q: Now, describe in detail the elongation phase of translation.

A: After initiation the ribosome continues sliding towards the 3' end of the mRNA template. It…

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…

A: After the process of transcription of DNA to RNA in the nucleus of the cell, ribosomes in the…

Q: How to identify the start site for transcription

A: The genome or genomic data of an organism refers to the complete set of its hereditary material…

Q: Which of the following statements regarding "start" and "stop" signals apply to both transcription…

A: Introduction The process of synthesising RNA from a DNA template, known as transcription, converts…

Q: The following DNA sequence has been determined from DNA isolated from a bit of prehistoric amber…

A: Here, a DNA sequence given and we are asked to write the polypeptide formed from this sequence. In…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Briefly explain the importance of the 5'-cap in the translation process. Do not simply define the…

A: Introduction :- During transcription, the 5' cap is inserted to the first nucleotide in the…

Q: what percentage of the total amino acids in the protein would be made up of proline (Pro)?

A: Proline is an amino acid codded by the codons CCG, CCC, CCU, and CCA. Any one of these codons can…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: The team would now like to establish the smallest possible deletion that would inactivate the…

A: Amino acid monomers form the building blocks of proteins. The arrangement of amino acids makes up a…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: 20. in differential translation, a different transcript may be recovered depending on which TATA box…

A: Translation: The process through which RNA codes for specific proteins is known as translation. It…

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: The disease cystic fibrosis is the result of a mutation in the gene that encodes the cystic fibrosis…

A: A codon is a DNA or RNA trinucleotide sequence encoding a particular amino acid or signaling the…

Q: List three molecular changes that take place in the processing of eukaryotic mRNA.

A: Eukaryotic mRNA goes through several changes before translating into protein. This s done to ensure…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Select one: O Met-Cys-Ala-Thr-Tyr---- O Met-Cys-Cys-Thr-Tyr--- O Met-Ala-Ala-Thr-Tyr---- O…

A: Aminoacyl tRNA synthetase are enzymes of extreme importance during the process of protein synthesis…

Q: Row A. B. C D. Protein Synthesis in an Animal elect the row below that correctly identifies the name…

A: Ribosomes create proteins as part of the biological process known as protein synthesis, which is…

Q: What is the total size of the mature i.e. fully processed mRNA in nucleotides?

A: Primary transcript of mRNA contains exons as well as introns. But After the process of splicing…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: The code for a fully functional protein is actually coming from an mRNA transcript that has…

A: The process of synthesis of proteins from mRNA is called as translation while the process of…

Q: process of eukaryotic transcription in detail and mention the specific enzyme

A: Transcription can be defined as the process of copying genetic information from one strand of the…

Q: Consider a gene being transcribed at a constant rate k1 and being degraded with first order…

A: The genetic information from protein synthesis is stored in DNA. This information is copied onto an…

Q: start with four exons and show mutually exclusive splicing producing 1-2-4 and 1-3-4 spliced exons.…

A: Mutually exclusive splicing is a phenomenon in which different exons are alternatively spliced,…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…

Q: protein. How would the protein produced from sequence #1 differ from the protein produced from…

A: The sequences provided are of a non-coding strand or template strand. mRNA is transcribed…

Q: 2a) In prokaryotes, a small ribosomal subunit can potentially get on an mRNA anywhere it can find…

A: The translation is the process of polymerization of amino acids to form polypeptides or protein. It…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: 1) List 5 factors involved in the process of either initation or elongation of translation

A: Translation is the process by which the genetic code contained within an mRNA is decoded to produce…

Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…

A: Transition refers to a point mutation that changes a purine nucleotide to another purine or a…

Q: The chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a…

A: Hi, Thanks For Your Question. Q2. Answer : The Maximum Score That A Sequence Can Have With This…

Q: What anticodon would a suppressor tRNA have to have to suppress a 5'UAA3' stop codon?

A: A mutation in the gene that changes its anticodon loop for a tRNA molecule can "suppress" nonsense…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: Discuss the concept and consequences of built-in redundancy as it applies to amino acid sequences.…

A: The amino acids are the building blocks of proteins.There are 20 different types of amino acids.…

Q: Any of the three STOP codons can signify the termination of translation. Select an answer and…

A: STOP codons are also known as nonsense codons.

Question

38. Assume that the reading frame is from left to right and that the columns represent transcriptional and translational alignments. Use the provided Genetic Code table.

DNA Double
G T
A
A
Helix
C
MRNA
A
C
A
C
C
Transcribed
TRNA
Anticodon
Amino Acid
Pro
Sequence
Amino Acid
Abbreviations
A,

Second letter
Key:
Ala = Alanine (A)
Arg Arginine (R)
Asn = Asparagine (N)
Asp Aspartate (D)
Cys Cysteine (C)
Gin = Glutamine (Q)
Glu = Giutamate (E)
Gly = Glycine (G)
His = Histidine (H)
lle Isoloucine (I)
Leu = Leucine (L)
Lys Lysine (K)
Met Methionine (M)
Phe = Phenylalanine (F
Pro Proline (P)
Ser = Serine (S)
Thr = Threonine (T)
Trp = Tryptopman (W)
Tyr Tyrosine (Y)
UGU]
UGC Cys
UGA STOP
UGG Trp
UUU
UCU
UCC
UAC Tyr
UAA STOP
UAG STOP
UUC Phe
Ser
UCA
UG
UUA
Leu
UUG
CUU
CUC
CCU
CC
CAU
CAC
}
CGU
CC
His
Leu
Pro
Arg
CUA
CUG
CCA
CCG
CAA
CGA
CAG Gin
GG
AUU
ACU
ACC
ACA
AGU
AGC
AAU
Ser
AUC le
AUA
AAC Asn
Thr
AAA
AGA
AUG Met
ACG
AAG Lys
AGG Arg
GUU
GCU
GCC
GAU
GGT
GGC
Gly
GUC
GAC Asp
Val
Ala
GCA
GCG
GUA
GAA
GGA
GAG Glu
GGG
GUG
Val -
Valine (V)
Third letter
अ० ५०
२० ०
First letter

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Number 10) Please put the following steps of eukaryotic protein synthesis in order from first (1) to last (4) _ 5' cap _ translocation out of nucleus _ splicing _ primary mRNA
5. a) Describe, using a diagram or point form notes, what is happening during transcription and translation of protein synthesis. Indicate where these events take place in the cell. b) An error occurs in the transcription of the original master strand of DNA. At the very first base pair, a guanine is substituted for cytosine. State the possible effects on the polypeptide and its functions.
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG
36.Start with two exons and an intervening intron. Include the cap and poly-A tail in your starting pre-mRNA. Show 2’-OH, 3’-OH, O-P-O phosphodiester bonds for the two transesterification reactions that splice exon 1 and exon 2. Be sure to include the branchpoint A and intron consensus sequences. You will need to show where the incoming -OH attacks the O-P-O bond to allow correct splicing in the lariat and between exons. Make your arrows precise. Show the lariat with the consensus sequences. Whenever possible, show 5’ and 3’ ends. Explain the fate of the lariat after it forms?
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
Matching type Choices are in the picture 1. simultaneous and rapid process producing mRNA and polypeptide 2. cleaving the polypeptide by adding water 3. three initiation factors are required to commence the process 4. removal of gene segment disrupting the message 5. single mRNA codes for the proteome
Give detailed Solution with explanation needed (don't give Handwritten answer, )
Sequence most commonly found at the boundary between exon-intron boundaries is at the 5' end and at the 3' end Question 33 options: G/GU; AG/G AG/G; G/GU A/GG; GG/U All of the above
Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of the manyways previously described is a loss-of-function _______?
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mu- tants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations- that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify MRNA sequences that could encode each of these amino acid sequences and deter- mine whether your codon assignments are consistent with the genetic code. Wild-type ... Lys-Ser-Pro-Ser-Leu-Asn-Ala. .. Double mutant - ..…
Briefly, describe one mode of post-translational modification that occurs once translation is finished.