Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds to the A site. 2. A peptide bond forms between the new amino acid and the growing polypeptide chain. 3. TRNA vacates E site as the next tRNA binds to the A site. 4. Both ribosomal subunits have bound, and the first tRNA is in the P site. 5. TRNA translocates to the P site, as upstream tRNA translocates to E site. 4, 1, 3, 2, 5 O 1, 3, 2, 4, 5 O 4, 1, 2, 5, 3 O 2, 4, 5, 1, 3 5, 4, 3, 2, 1

Choose the answer that has these events of protein synthesis in the proper sequence. 1. A TRNA binds to the A site. 2. A peptide bond forms between the new amino acid and the growing polypeptide chain. 3. TRNA vacates E site as the next tRNA binds to the A site. 4. Both ribosomal subunits have bound, and the first tRNA is in the P site. 5. TRNA translocates to the P site, as upstream tRNA translocates to E site. 4, 1, 3, 2, 5 O 1, 3, 2, 4, 5 O 4, 1, 2, 5, 3 O 2, 4, 5, 1, 3 5, 4, 3, 2, 1

Name: Choose the answer that has these events of protein synthesis in the p
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Choose the answer that has these events of protein synthesis in the propersequence.1. A TRNA binds to the A site.2. A peptide bond forms between the new amino acid and the growing polypeptidechain.3. TRNA vacates E site as the next tRNA binds to the

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 18RQ: A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell...

See similar textbooks

Similar questions

Choose the answer that has these events of protein synthesis in the proper sequence. (Note some steps may be missing) A peptide bond forms A small ribosomal subunit binds with the mRNA. The tRNA leaves the P site, and the ribosome translocates to the P site. The Methionine initiator-tRNA binds to the start codon. An incoming amino-acyl tRNA binds to the A site The large ribosomal subunit binds the small subunit Group of answer choices A 4, 1, 2, 5, 6, 3 B 2, 4, 6, 5, 1, 3 C 1, 3, 2, 4, 5, 6 D 4, 1, 3, 2, 5, 6 E 5, 4, 3, 2, 6, 1
Choose the correct sequence for Translation process. 1. Translocation of the large subunit 2. Formation of peptide bond 3. Translocation of the small subunit 4. TRNA binding O4,1,2,3 O 2,4,3,1 O4,2,1,3 O 1,2,3,4
A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this TRNA? O A. The tRNA will not bind to this codon. O B. Translation stops and the protein is released. O Č. The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome. vered MacBook Air 80 F3 D00 D00 F4 F2 F5 % & 23
Which RNA molecule(s) are modified at the 5' and 3'ends in eukaryotes? 1. 2. MRNA tRNA FRNA 3. 4. 5. tRNA and MRNA FRNA and tRNA 6. Which one is NOT a function of the Signal Recognition Particle (SRP) in protein targeting? 1. 2. peptide formation of a 9-12 amino acid long sequence binding to a signal sequence preventing elongation factors binding during translation guiding the ribosome to the endoplasmic reticulum halting translation 3. 4. 5. 7. Which prokaryotic enzyme is equivalent to the eukaryotic Mcm2-7? 1. 2. Primase Helicase or DnaB DNA polymerase DNA polymerase II DNA ligase 3. 4. 5. 8. Recombination is associated with 1. 2. HIV and genome integration. gene therapy involving the use of viruses. generating genetic diversity. Option 1 and 2 are both correct. Option1, 2 and 3 are all correct. 3. 4. 5. 9. Which component of a western-blot allows for the specific detection of a protein of interest? 1. 2. polyacrylamide gel buffer 3. 4. antibodies chromogenic substrate membrane 5. 5.
Rank the steps of protein production in the order in which they occur. (1 = occurs first, 10 = occurs last) Initiation factors bind the small ribosomal subunit which recognizes the Shine Dalgarno sequence in the MRNA V[Choose] 6. 2 Elongation factors escort the aminoacyl 9. TRNA to the vacant A site of the ribosome 1 MRNA is spliced in the spliceosome to 10 remove introns 7 N-formylMethionine tRNA recognizes the start codon and recruits the large ribosomal [ Choose] subunit Translocation moves the uncharged tRNA to the E site and the recently extended tRNA is moved from the A site to the P site [ Choose ] DNA is transcribed into mRNA in the nucleus with the help of RNA polymerase [ Choose ] The newly formed polypeptide chain heads to the ER where it undergoes post- ( Choose] translational modifications Transcription factors bind DNA and help initiate the process of transcription [Choose ] Release factors recognize the stop codons and cause dissociation of the ribosome from ( Choose]
Give typing answer with explanation and conclusion Which of the following statements regarding the structure and function of tRNA is true? A-The codon / anticodon pairing is absolutely universal among organism. B-The charging of a tRNA does not require energy. C-There are 64 different tRNAs, one for each possible codon. D-Reading 5' to 3', the first base in the anticodon can participate in non Watson and Crick base pairing E- The 3' end of each tRNA has a unique sequence so a specific amino acid can be attached.
Give typing answer with explanation and conclusion Which of the triplets below is a possible anticodon for a tRNA that transports proline to a ribosome? Use your genetic code. Group of answer choices 3′-UUC-5′ 3′-CCG-5′ 3′-GGC-5′ 3′-CCC-5′
The tRNA molecule indicated below delivers amino acids that are incorporated into protein. What is the function of: D loop - Anticodon Loop- TC Loop- acceptor stem-
For the mRNA strand above, use the codons and the diagram below to determine what amino acids will be brought by the tRNA and the order that they will bond together.
Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?
What is the role of ribosomes in protein synthesis? * A. they carry proteins to the site of action B. they provide a source of amino acids C. they provide a site from tRNAs to link to mRNAs D. they translate the basic DNA code using tRNA Consider the following DNA bases sequence 3' TAT CGG 5'. what dipeptide is formed if a DNA point mutation converts CGG to CGT? * A. Val-Ala B. Asp-Glu C. Ala- Ala D. Gly-Ala A tRNA molecule possesses the anticodon 5' CGU 3' , which amino acid will this tRNA molecule carry? * A. Threonine B. Valine C. Alanine D. Arginine What will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate…
The tRNA molecule shown above would be found in the Row A B. C. 3. B D. ect one: A. A i nucleus nucleus cytoplasm cytoplasm amino acid attachment site ii leucine i of a cell, and would carry the amino acidii (select the row that asparagine leucine (an amino acid) asparagine UUA anticodon