BHI TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACT M13-20 primer binding site Bsp 1061 goi Primer design worksheet T7 Promoter ...KS primer binding site Primer 17 primer binding site Hind EcoRV EcoRI Pal Eco01091 Xhol Kpn Dra CACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC... Acc Xbal Smal BamHI Spel ...GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC... SK primer binding site KS primer binding site... Socl Not Eagl Batx I Sac II The diagram above shows a portion of the pSK+ multicloning site. For this worksheet, you need to design primers that could be used to amplify a gene cloned into the EcoRI cloning site. There are 4 primer sites indicated on the diagram. The primers need to be designed to bind to each of the primer binding sites indicated on the diagram. Fill in the following information: Identify all possible Forward primers and write out their sequence: 5'-3' sequence

Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:Elaine N. Marieb, Katja N. Hoehn
Chapter1: The Human Body: An Orientation
Section: Chapter Questions
Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...
icon
Related questions
Topic Video
Question
**Primer Design Worksheet**

The diagram above shows a portion of the pSK+ multicloning site. For this worksheet, you need to design primers that could be used to amplify a gene cloned into the **EcoRI** cloning site.

There are 4 primer sites indicated on the diagram. The primers need to be designed to bind to each of the primer binding sites indicated on the diagram.

**Fill in the following information:**

**Identify all possible Forward primers and write out their sequence:**

- **Primer**  
  5’-3’ sequence  

**Identify all possible Reverse primers and write out their sequence:**

- **Primer**  
  5’-3’ sequence

---

**Diagram Explanation:**

- The graphic shows a DNA sequence with labeled regions including restriction enzyme sites (e.g., **BssH II**, **Nhe I**, **EcoRI**), a **T7 Promoter**, and primer binding sites (**M13 -20**, **T7**, **KS**, **SK**).

- The sequence is labeled at several restriction sites with their enzyme names, illustrating where cuts can be made for gene cloning.

- Arrows indicate the orientation of the **T7 promoter** and primer binding sites, showing which direction the primers should be designed to bind.

- The goal is to use this map to determine forward and reverse primers for amplifying the gene at the EcoRI site.
Transcribed Image Text:**Primer Design Worksheet** The diagram above shows a portion of the pSK+ multicloning site. For this worksheet, you need to design primers that could be used to amplify a gene cloned into the **EcoRI** cloning site. There are 4 primer sites indicated on the diagram. The primers need to be designed to bind to each of the primer binding sites indicated on the diagram. **Fill in the following information:** **Identify all possible Forward primers and write out their sequence:** - **Primer** 5’-3’ sequence **Identify all possible Reverse primers and write out their sequence:** - **Primer** 5’-3’ sequence --- **Diagram Explanation:** - The graphic shows a DNA sequence with labeled regions including restriction enzyme sites (e.g., **BssH II**, **Nhe I**, **EcoRI**), a **T7 Promoter**, and primer binding sites (**M13 -20**, **T7**, **KS**, **SK**). - The sequence is labeled at several restriction sites with their enzyme names, illustrating where cuts can be made for gene cloning. - Arrows indicate the orientation of the **T7 promoter** and primer binding sites, showing which direction the primers should be designed to bind. - The goal is to use this map to determine forward and reverse primers for amplifying the gene at the EcoRI site.
Expert Solution
trending now

Trending now

This is a popular solution!

steps

Step by step

Solved in 2 steps

Blurred answer
Knowledge Booster
Mitochondrial mutations
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:
9780134580999
Author:
Elaine N. Marieb, Katja N. Hoehn
Publisher:
PEARSON
Biology 2e
Biology 2e
Biology
ISBN:
9781947172517
Author:
Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:
OpenStax
Anatomy & Physiology
Anatomy & Physiology
Biology
ISBN:
9781259398629
Author:
McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:
Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:
9780815344322
Author:
Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:
W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:
9781260159363
Author:
Martin, Terry R., Prentice-craver, Cynthia
Publisher:
McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Inquiry Into Life (16th Edition)
Biology
ISBN:
9781260231700
Author:
Sylvia S. Mader, Michael Windelspecht
Publisher:
McGraw Hill Education