What happens during translation? Key Vocabulary from Unit 4.2 Answer using 3-5 complete sentences and at least 5 of the key vocabulary terms. Answers should be entirely in your own words. Transcription Translation DNA MRNA TRNA Amino acid Protein Nucleotide Nucleus Submit Ribosome Codon Base pairs Adenine, Thymine, Guanine, Cytosine, Uracil Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit 4.2 Transcription Translation DNA Transcription takes place in the MRNA tRNA Amino acid Protein Nucleotide Nucleus Ribosome Codon Base pairs Adenine, Thymine, Guanine, Cytosine, Uracil

Q: Not all the bases of an mRNA message are used for coding. Which of the following is a possible…

A: mRNA  is messenger RNA that is translated by the ribosomes and generate a protein product. It has…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: 13' 5' 13' + A represents spliceosome introns and B represents Group II introns A represents Group…

A: Exons can be defined as expressing sequences whereas introns can be defined as intervening…

Q: What two types of molecules are involved when a codon pairs with its anticodon?

A: Ans. Genetic code is a term used to identify the four bases of DNA, A, C, G, and TS, in a way that…

Q: What happens during transcription? Answer using 3-5 complete sentences and at least 5 of the key…

A: The central dogma states that the pattern of information in our cells is from DNA to make new DNA (…

Q: QUESTION 2 Which of the following is truly responsible for translation, in other words what directly…

A: Translation is a process in which cell create protein by using the genetic information which carried…

Q: TRANSCRIPTION The DNA provided for your animal is one side of the double helix. DNA - MRNA 1.…

A: Information coded in the DNA is transcribed in the form of mRNA, these mRNA then translate this…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: AUG is the most common start codon found in translated genes. Which of the following is true of…

A: The start codon is the initial set of codons in an mRNA transcript that is translated by a ribosome.…

Q: Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA…

A: The core dogma notes that the sequence of learning most commonly found in our cells is: From…

Q: cleotides                nucleus                      adenine                      cytosine…

A: The process in which DNA forms RNA is called transcription and the process in which RNA forms…

Q: Question 6 of 10 Categorize each of the following descriptions as MRNA, FRNA, or tRNA. NOTE: Some…

A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: The mRNA is produced by the process of transcription. It takes place in the nucleus. The RNA…

Q: An enzyme is needed for the Krebs Cycle.  It will be made following the directions contained in a…

A: In eukaryotes, the genetic information needed for all cellular processes is encoded by genes, which…

Q: Which of the following processes occur on the mRNA during and/or after transcription but before…

A: Introduction  Gene expression is the process of activating a particular gene so that messenger RNA…

Q: TRNAS contain the anticodon that interacts with [Select ] [Select] TRNAS MRNAS pre-RNAS

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum create…

Q: Need help Below is a strand of mRNA with three codons listed on the strand. Imagine the mRNA strand…

A: Translation is a process of reading of mRNA to form proteins. It requires several components ljke…

Q: codon table st ition A U Phe Ser Tyr Phe Ser Tyr Leu Ser stop Leu Ser stop Leu C Leu Leu Leu Pro His…

A: In the sequence fill ups we can see that few sequences are given in DNA, mRNA,  tRNA and  amino…

Q: O Type here to search #11 protein endoplasmic reticulum DNA vesicle RNA nucleus Golg ribosome…

A: Introduction:- Eukaryotic cells have well defined nucleus and they also consists of various membrane…

Q: QUESTION 43 Why is only one strand of DNA transcribed into mRNA? a. Because mRNA is only required in…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 8 7 2 6. 3 4 000 000 DO0

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: Question 1: Contrast the roles of tRNA and mRNA during translation and list all enzymes that…

A: Transcription Transcription is the process by which DNA sequence is copied to mRNA, by enzyme RNA…

Q: Contains nitrogenous base and pentose sugar v One copy of all chromosqmes in cell DNA Nucleotide…

A: a)Nucleotide: Contains nitrogenous base, pentose, and phosphate

Q: What is the name for the step where RNA is created from a strip of DNA? Transcription Translation…

A: Introduction:- Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are most important molecules…

Q: QUESTION 1 Shown below is the 5' end of an mRNA. Translation of this mRNA should begin at nucleotide…

A: mRNA consists of different three nucleotide codons that will eventually code for different amino…

Q: 1. Below is a gene on DNA in a prokaryotic cell. Draw the mRNA molecule that would be made from this…

A: It can exist in various forms like primary, secondary and tertiary based on its level of…

Q: 39) Use the following information to answer the question. A part of an MRNA molecule with the…

A: Introduction-  The genetic information of living organisms is stored in the cell in the form of DNA.…

Q: Second base of codon C A UUU Phenylalanine UCU UAU UGU Cysteine U Tyrosine tyr y U UUC phe F UCC…

A: The process of protein synthesis is called translation. messenger RNA, transfer RNA and ribosomes…

Q: gea albbiM Obj 29 Identify the specific terms applied to transcription and translation described by…

A: Transcription and translation are two critical processes in the central dogma of molecular biology.…

Q: - up to 2 minutos): Which of the following statements about the genetic code is(are) true? OA Each…

A: Genetic code: It is a dictionary that involves a sequence of nucleotides and amino acids which is…

Q: 6. If you are given the DNA sequence: T-A-C-C-G-A-A-T determine the complementary RNA strand.

A: Introduction :- The term "DNA sequencing" refers to a common laboratory procedure for determining…