What happens during translation?Key Vocabulary from Unit 4.2Answer using 3-5 complete sentences and at least 5 ofthe key vocabulary terms.Answers should be entirely in your own words.TranscriptionTranslationDNAMRNATRNAAmino acidProteinNucleotideNucleusSubmitRibosomeCodonBase pairsAdenine, Thymine, Guanine, Cytosine, Uracil Use one of the vocabulary words to fill in the blank. Check your spelling.Key Vocabulary from Unit 4.2TranscriptionTranslationDNATranscription takes place in theMRNAtRNAAmino acidProteinNucleotideNucleusRibosomeCodonBase pairsAdenine, Thymine, Guanine, Cytosine, Uracil

Translation The process of making a protein from the information contained in a molecule of…

Answered: What happens during translation? Key…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
Amino acid Large subunit of ribosome tRN4 Small subunit of ribosome mRNA Anticodon Submit Request Answer Chamon 4rl Torms of Use | Privacy Policy | Permiss
Codons The genetic code consists of triplets of nucleotides called codons. Refer to the genetic code chart provided to answer the following questions. What is unique about the codon AUG? 2. What is unique about the codon UGA?
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation ⚫ Which position shows the "A" position? middle (contains blue tRNA) . Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the end of the anticodon? the C CUAGAC AGAUCUGCUACUAGUAACACGU
Which molecules are required during Translation? Choose ALL that apply Select all that apply: mRNA tRNA rRNA DNA cytoplasm nucleus
nce.com/student/studentformative/ Online Tools Question 6 (2017 6C) A model of a biological process is shown. MRNA 3' AGCUGACC G GACA A GAU CG C Asp Ala Leu teu What is the purpose of this process? Answer To replicate the DNA of an organism before cell division G To assemble nucleotides in an mRNA chain along DNA template H To synthesize amino acids used to unzip strands of DNA and copy the genetic code To translate the genetio code into a specific sequence of amino acids chnologies InTC 2021 - Edugence MB
Add-ons Help Last edit was 4 minutes ago Times New.. - BIUA 11 + Using the table the other page- transcribe the RNA sequence int codons and their amino acids: CAU TTG TAU UTA AAA TGG GCG Translation Mechanics Now that you are an expert code breaker, we can start to talk about thanslation. Let's go over the key players in the process. MRNA. The mRNA is the code that is translated into a functional protein. It is created through transcription and a series of subsequent editing steps, which we have described in detail already. The mature mRNA comprises codons that will code for the production of a protein. lili 日

AKS 5c1: Which explanation accurately describes the model below? * DNA MRNA Transcription Mature MRNA Nucleus Transport to cytoplasm for protein synthesis (ranstation MANA Cell membrane This model represents protein synthesis since the tRNA is delivering amino acids to form a polypeptide chain that will form a protein. This model represents protein synthesis since the tRNA is delivering lipids which will be used to bond proteins to form an enzyme. This model represents protein synthesis because DNA is being copied during transcription in the nucleus before leaving the nucleus. This model represents protein synthesis because MRNA is coiling to form a new protein molecule in the cytoplasm.
Typed explanation only Codons in mRNA molecule and their corresponding amino acids UUU Phenylalanine UAU tyrosine UUA leucine UAA nonsense GCA alanine AAU asparagine AAG lysine UGC cysteine GUU valine UCG, UCU serine Refer to Table 8.2. If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Group of answer choices 5' TGTGCTTTCTTA 3' 3' AGACGTTTCAAT 5' 3' UGUGCAAAGUUA 5' 5' AGAGCTTTGAAT 3' 3' TCTCGTTTGTTA 5'
Answer the following questions regarding the diagram (below) showing translation. The ribosome is shown as the blue and green structure, the RNA is the horizontal line labeled with nucleotide abbreviations, and the tRNAs are shown as colored blocks with the anticodon paired to the codon. • What stage of translation is shown? elongation • Which position shows the "A" position? right side (no tRNA) • Which end of the RNA is the 5' end? left end • Which base of the anticodon of the blue tRNA "GAC" (as shown in the diagram) is the 5' end of the anticodon? the C U! UCUGCUACUAGUAACACGU
I need help with a matching biology question: This is a single stranded molecule that in Eukaryotes passes from the nucleus to the cytoplasm. This makes up the ribosomal subunits and reads the mRNA. They carry amino acids during the process of translation. The structure is the site of translation. This is the enzyme complex that is used to copy DNA during transcription matched with: ribosome mRNA rRNA tRNA RNA polymerase
ITEM BANK: Move to Bottom Amino Acids Translation M No drag and droo answer here Nucleus mRNA Wamennin Ribosome drag and drop answer here drag and drop answer here MET LEU Transcription drag and drop answer here drag and drop answer

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS