**Part 5: Coding Practice** 1. Use this sequence of DNA to answer the following former test questions: 5'-- TTAATGGGACAGCTTGTTGTAGAGG --3' a. What is the complementary strand of DNA? b. Using the complementary strand of DNA (your answer from part a) as the template strand, what is the transcribed mRNA sequence? c. What is the amino acid sequence translated from the strand of mRNA synthesized in part b (use the genetic code below)? Remember: i. Start codon! ii. Stop codon! **Genetic Code Chart:** The chart provides a codon table used to translate mRNA sequences into amino acids. - It is structured as a grid with the first letter of the codon listed vertically, the second letter listed across the top horizontally, and the third letter to the right. - Each cell in the grid corresponds to an amino acid abbreviation, which is determined by the combination of the three letters (codon) from the mRNA sequence. - Start reading from the 'AUG' for methionine (Met), which is the start codon. - Stop codons are UAA, UAG, and UGA, which signal the termination of protein synthesis. The sequences are categorized by: - **First letter (left column):** - U, C, A, G - **Second letter (top row):** - U, C, A, G - **Third letter (right context):** - U, C, A, G For each combination of letters, the corresponding amino acid is provided. The table supports understanding of how to decode an mRNA sequence into a polypeptide chain.
Molecular Techniques
Molecular techniques are methods employed in molecular biology, genetics, biochemistry, and biophysics to manipulate and analyze nucleic acids (deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)), protein, and lipids. Techniques in molecular biology are employed to investigate the molecular basis for biological activity. These techniques are used to analyze cellular properties, structures, and chemical reactions, with a focus on how certain molecules regulate cellular reactions and growth.
DNA Fingerprinting and Gel Electrophoresis
The genetic makeup of living organisms is shown by a technique known as DNA fingerprinting. The difference is the satellite region of DNA is shown by this process. Alex Jeffreys has invented the process of DNA fingerprinting in 1985. Any biological samples such as blood, hair, saliva, semen can be used for DNA fingerprinting. DNA fingerprinting is also known as DNA profiling or molecular fingerprinting.
Molecular Markers
A known DNA sequence or gene sequence is present on a chromosome, and it is associated with a specific trait or character. It is mainly used as a genetic marker of the molecular marker. The first genetic map was done in a fruit fly, using genes as the first marker. In two categories, molecular markers are classified, classical marker and a DNA marker. A molecular marker is also known as a genetic marker.
DNA Sequencing
The most important feature of DNA (deoxyribonucleic acid) molecules are nucleotide sequences and the identification of genes and their activities. This the reason why scientists have been working to determine the sequences of pieces of DNA covered under the genomic field. The primary objective of the Human Genome Project was to determine the nucleotide sequence of the entire human nuclear genome. DNA sequencing selectively eliminates the introns leading to only exome sequencing that allows proteins coding.
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
