1. What is the difference between leading and lagging strand?

Q: A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a mutation…

A: Nonsense codon The mRNA sequences; UAA, UAG, UGA signals the termination of the process of…

Q: 2. Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: A single-stranded DNA sequence may be written as: 3'-AGGTACT-5: Which of the following could be…

A: DNA or Deoxyribonucleic acid is the genetic material of almost all biological organisms(some have…

Q: Below is a DNA parent strand. What would be the daughter strand to this? What step of cell…

A: DNA replication is the process by which a cell makes an identical copy of its DNA before cell…

Q: My Courses Need Help? My courses > ELGINBIO108S21 | Section 701 > Cell Division: Mitosis & Meiosis >…

A: The G1 ,S, and G2 phases  together are known as interphase. G1 phase also called the first gap…

Q: Unzipped Single Strand of DNA Complementary Strand of DNA Build the complementary strand of DNA to…

A: A nucleotide is the basic building block of nucleic acids. Ribonucleic acid (RNA) and…

Q: 3. Using the double stranded bacterial sequence provided below: ( - Indicate the promoter sequence…

A: All description given in this question though in brief transcription is a process where RNA produce…

Q: 11. What are the 3 steps involved in replication? Show DNA replication using the following DNA…

A: Genetic information present in double stranded DNA molecule is transmitted from one cell to another…

Q: 13' 5' 13' + A represents spliceosome introns and B represents Group II introns A represents Group…

A: Exons can be defined as expressing sequences whereas introns can be defined as intervening…

Q: The Structures of Genetic Material • DNA is made up of called a • DNA is made up of consisting of 3…

A: Deoxyribonuclic acid (DNA) is an organic molecule or compaund, which contains genetic information as…

Q: 3. The diagram below shows a DNA replication bubble in a salmon cell. The circles indicate the…

A: Q.The diagram below shows a DNA replication bubble in a salmon cell. Do the circles indicate the…

Q: 3. One repair mechanism for double-strand breaks involves the unwinding of the damaged DNA followed…

A: DNA repair is the correction of incorrect nucleotides or missing nucleotides in a single strand or…

Q: Fill in the blanks in the following statements about DNA replication. 3' Parental strand 5' 2. Then…

A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…

A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…

Q: 11. The template DNA for the beginning a gene is 3' – GATACATGAGGCGATACG – 5'. What mRNA transcript…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 4. A binds with 5. What enzyme prevents recoiling of the DNA strand while synthesis is occurring?…

A: DNA replication is the process by which a cell makes an identical copy of its entire genome, which…

Q: 7.) Give the base sequence of the complementary strand of DNA in this molecule. Label the 5' and 3'…

A: DNA is also called as Deoxyribonucleic acid which is an polymer composed of two polynucleotide…

Q: What is the BEST explanation for why DNA replication is discontinuous at the lagging strand? А. DNA…

A: DNA possesses information for an individual to develop, survive and reproduce. The hetero catalytic…

Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…

A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…

Q: 5- What’s the purpose of the DNA extraction? a- Force the cell to make more DNA b- Kill the cells.…

A:

Q: Produces Leaves the nucleus and goes to the... 7. Transcription and Translation---DNA: A A…

A: Piece's of RNA make amino acids, which make proteins and this process occurs in the Cytoplasm. m RNA…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: Match the proteins to their functions in DNA replication. DNA polymerase RNA polymerase Helicase…

A: Eukaryotic cells' nuclei and prokaryotic cells' nucleoid regions are where DNA replication takes…

Q: DNA replication is semi-conservative and results in each new cell receiving a copy composed of 1 new…

A: DNA or deoxyribonucleic acid is the biomolecule that carries the genetic information in a coded form…

Q: AKS 5c: Students are debating what is happening in the two processes that are shown in the image…

A: The central dogma of molecular biology, given by Dr. Francis Crick states that the information…

Q: 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop…

A: Transcription and translation are terms used to describe two distinct biological processes: the…

Q: QUESTION 43 Why is only one strand of DNA transcribed into mRNA? a. Because mRNA is only required in…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: 8 7 2 6. 3 4 000 000 DO0

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: (AKS 8a2 DOK 2) Some students in the biology classes at Meadowcreek HS analyzed DNA on a gel. The…

A: DNA fragments are negatively charged, so they move towards the positive electrode. Because all DNA…

Q: 11. Now imagine that a mutation occurred in the second T of the codon below and the T became a G.…

A: Introduction: The genetic macromolecule referred to as DNA is highly stable with regards to its base…

Q: hi i need help with science homework if you do i give 5/5  if this sample is good i might even sign…

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Drag the tiles into the Venn diagram to compare prokaryotic and eukaryotic cells. Prokaryotic Cell…

A: Introduction In biology, the base unit can exist on its own and is made up of all living creatures…

Q: (AKS 8, DOK 1) The flounder is a species of fish that can live in very cold water. The fish produces…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…

Q: Post-translational modifications of proteins may include which of the following processes? Hint:…

A: Please follow steps 2 & 3 for a detailed explanation of both questions.

Q: Since the first nucleotide cannot be directly linked in a newly synthesized strand in DNA…

A: Introduction DNA replication is the cloning of DNA molecule , in which each strand of DNA molecule…

Q: AKS 5c1: A section of a nucleic acid is shown in the model below. The process represented in the…

A: Nucleic acids are one of the most important biomolecules of living system. There are two types of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.