I need help with this biology homework question. AKS 5c: Use the model below to answer the question that follows. Whichstrand and process correctly describe Strand C in the model?*Btrand A TACOTTAGACAAGTOCOTGAOTACA CAAATCTOITSSrand BATCÇÇAÇTÇATSTOTStrand CAU ÇCOCAAUCU UUCAC CACUCAU UCUMelProGinSerValHisAlaLeuMet Cys) Strand C is DNA. Strand C is part of DNA replication.() Strand C is tRNA, Strand C is only involved in translation.Strand C is MRNA. Strand C is involved in transcription and translation,Strand C is DNA. Strand C is involved only in transcription.

AKS 5c: Use the model below to answer the question that follows. Which strand and process correctly describe Strand C in the model? GAGTACACA ACSCACTCAISIS Strand A TA CGO Strand BATOC Strand C AUGCCCAAUCUCUUCACICACUCAUCUU TTTT Met Pro Gin Ser Val His Ala Leu Met Cys OStrand C is DNA. Strand C is part of DNA replication. Strand C is TRNA. Strand C is only involved in translation. Strand is MRNA. Strand Cis involved in transcription and translation. () Strand C is DNA. Strand C is involved only in transcription.

AKS 5c: Use the model below to answer the question that follows. Which strand and process correctly describe Strand C in the model? GAGTACACA ACSCACTCAISIS Strand A TA CGO Strand BATOC Strand C AUGCCCAAUCUCUUCACICACUCAUCUU TTTT Met Pro Gin Ser Val His Ala Leu Met Cys OStrand C is DNA. Strand C is part of DNA replication. Strand C is TRNA. Strand C is only involved in translation. Strand is MRNA. Strand Cis involved in transcription and translation. () Strand C is DNA. Strand C is involved only in transcription.

Anatomy & Physiology

1st Edition

ISBN:9781938168130

Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Publisher:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark Womble

Chapter3: The Cellular Level Of Organization

Section: Chapter Questions

Problem 17RQ: Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG...

See similar textbooks

Similar questions

AKS 5c: Which of the following answers below accurately describes Strand C in the model? * Strand A TACG CACA Strand B A Strand C AUGCO UGU Met Pro Gin Ser Val His Ala Leu Met Cys Strand C is tRNA. Strand C is only involved in translation. Strand C is DNA. Strand C is part of DNA replication. Strand C is DNA. Strand C is involved only in transcription. Strand C is mRNA. Strand C is involved in transcription and translation. AKS 5c1: Using codon wheel below, which of the models correctly represents the Hence of events and.creationof bacenairing rule +he O O
State if the DNA is written 5' to 3' or 3' to 5' Transcribe the sequence. Include the 5' and 3' Translate the sequence (codon chart included) +1 TAGTCCAAAGGTTTACGTAAATGGGATGTCGAAATTGACTAGATCA
Complete the complementary strand: DNA replication ATTCGAGGCTAA
IV - COMPLETION: Complete the table below, supply the viven DNA template to its correct pair and give the correct codon and amino acid using the codon chart. DNA ATG UUG ACG GCA TAG DNA MRNA FRNA Amino Acid
2)One strand of DNA reads: CGACTTCAGAT What would the complementary strand be?
Base on the coding strand of DNA: ATG GGA ATT CGC What is the sequence of the complementary template strand of DNA that pairs with the coding strand?
ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
DNA Template: AAC CGA TCC TAT CGG AAA TTT TGC ATG ATC TAT Give the nucleotide sequence after DNA replication, give the mRNA nucleotide sequence, & give the amino acids translated from the mRNA molecule. What is the stop codon in the sequence?
AUG Met ACG ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: 5-AGA-ACT-AAA-СТА-ТCG-СТT-CGT-3 DNA daughter strand: hnRNA: MRNA: original protein: mutated MRNA: mutated protein: second letter G UCU UUU Phe UAU Tyr UGU UGC Cys UAA stop UGA stop| A UAG stop UGG Trp UUC UCC UAC Ser Leu UCA UUG UUA UCG G CUU CCU CAU CGU His CAC CAA CUC C CGC Leu CUA Pro Arg A ССА CGA Gln CAG CUG CCG CGG AUU ACU AAU AUC lle A AUA AAC Asn AAA AGC AGA AGU Ser ACC Thr АСА AAG LyS GAU ASP AUG Met ACG AGG Arg G GUU GCU GGU) GUC GCC GAC GGC Val GUA GCA Ala GAA Gly GGA A Glu GUG GCG GAG GGG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letter
Which of the following sequences on a DNA molecule would be complementary to GCTTATAT? TAGGCGCG ATCCGCGC CGAATATA TGCCTCTC
Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…
D. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. α