4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide that is five amino acids long. Answer the following questions. ТАСАTGATCATTTСАCGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is transcribed and in which direction? Label the 5 and the 3` ends of each strand. Copy the strands on your answer sheet. b. If the bottom strand is transcribed from left to right, give the base sequence, and label the 5`and 3` ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid? c. How is initiation of transcription in prokaryotes different to eukaryotes?

Q: uestion The sun's energy evaporates water from oceans, which cover approximately 71% of Earth's…

A: Evaporation is that the process of a substance during a liquid state changing to a gaseous state…

Q: need the top one answered

A: The correct answer is option B . Studying in Short blocks and taking periodic breaks .

Q: flew from Montreal to Ottawa to speak with Prime Minister Trudeau recently flew with President Biden…

A: INTRODUCTION The red vented bulbul is the first animal except human found to be incapable of…

Q: Identify the following muscles: 1 What is the group of muscles on the posterior thigh? 2 What muscle…

A: Due to our answering policy, we can only answer one question at a time. Kindly post the other…

Q: i need help answering a and b the graph is the first picture  thank you

A: The cellulase is an enzyme that is responsible for the breakdown of cellulose (a polysaccharide)…

Q: Concerns of Electronic Health Records (EHR)

A: Electronic Health Records (EHR) integration has revolutionized healthcare yet concerns persist. From…

Q: 21 PS Z2

A: The given diagram is of the stage of cell division.  Phases of cell division are: G1 phase or gap 1…

Q: Ali tries to train his horse but he fails) but" is" ( noun verb adverb adjective preposition pronoun…

A: Training is the giving of information or knowledge. Training is given to increase skills.

Q: I need help with these

A: The five basic types of chemical reactions are combination, decomposition, single-replacement,…

Q: How does the drug interfere with the normal function of the neurotransmitter(s)? What effects are…

A: Drugs are usually used as medicines to help pateints to cope with illness like insomnia, depression,…

Q: Please fill in the blank in the picture, thank you

A: Skeletal muscles are characterized by their voluntary nature. These are striated muscles that are…

Q: what is triple code Your answer

A: Genetic code can be described as the ordering of nucleotides in DNA molecules which carries the…

Q: Receptor stimulus processor signal conductor analyzer organ eye

A: Our eyes are sense organs for vision. They also help in perception of colour. Human beings have two…