Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 22QP
Make the complementary strand for the following DNA template and label both strands as 5′ to 3′ or 3′ to 5′ (P = phosphate in the diagram). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
template: P—AGGCTCG—OH
new strand:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
Template : P- AGGCTCG-OH
New strand :
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many total hydrogen bonds are in this double strand of DNA?
Template : P- AGACTTG-OH
New strand :
Make the complementary strand for the following DNA template and label both strands as 5’ to 3’ or 3’ to 5’ (hint: determine first if P = phosphate or –OH are the 5’ or 3’ end of the strand). Draw an arrow showing the direction of synthesis of the new strand. How many hydrogen bonds are in this double strand of DNA?
Template : P- AGACTTG-OH
New strand :
Chapter 8 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 8.4 - Two genes associated with breast cancer, BRCA1 and...Ch. 8.4 - Prob. 2GRCh. 8 - What are Bruces options at this point? Bruce and...Ch. 8 - Should he reconsider and try chemotherapy instead?...Ch. 8 - Should he go ahead and enroll on the chance that...Ch. 8 - Until 1944, which cellular component was thought...Ch. 8 - Why do you think nucleic acids were originally not...Ch. 8 - Prob. 3QPCh. 8 - In the experiments of Aery, MacLeod, and McCarty,...Ch. 8 - Read the following experiment and interpret the...
Ch. 8 - Recently, scientists discovered that a rare...Ch. 8 - List the pyrimidine bases, the purine bases, and...Ch. 8 - In analyzing the base composition of a DNA sample,...Ch. 8 - The basic building blocks of nucleic acids are: a....Ch. 8 - Adenine is a: a. nucleoside b. purine c....Ch. 8 - Polynucleotide chains have a 5 and a 3 end. Which...Ch. 8 - DNA contains many hydrogen bonds. Are hydrogen...Ch. 8 - Prob. 13QPCh. 8 - State the properties of the WatsonCrick model of...Ch. 8 - Using Figures 8.7 and 8.9 as a guide, draw a...Ch. 8 - A beginning genetics student is attempting to...Ch. 8 - Chemical analysis shows that a nucleic acid sample...Ch. 8 - Prob. 18QPCh. 8 - RNA is ribonucleic acid, and DNA is...Ch. 8 - What is the function of DNA polymerase? a. It...Ch. 8 - Which of the following statements is not true...Ch. 8 - Make the complementary strand for the following...Ch. 8 - How does DNA replication occur in a precise manner...Ch. 8 - Nucleosomes are complexes of: a. RNA and DNA b....Ch. 8 - Discuss the levels of chromosomal organization...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?arrow_forwardFor the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strandarrow_forwardLook at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow. 5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’ 3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’ Primer #1: 3’ A C G A T T T 5’ Primer #2: 5’ G G A C G T A 3’arrow_forward
- Consider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forwardDetermine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. the tRNA 4. the formed amino acidsarrow_forwardin DNA replication, if the template strand is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the newly synthesized DNA strand? Write the sequence from 5’ to 3’.arrow_forward
- DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence 5’-CCG ATC GCA CAA-3’ Using this sequence as template after transcription no protein can be translated. Why? Presence of start codon Absence of start codon Due to mutation If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)? Substitution of C with G No change4 Deletion of Both I & IIIarrow_forwardDNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the other one will go from 5’ to 3’ direction. During replication or transcription, whatever the process is, it will always follow the 5’ to 3’ direction using the 3’ to 5’ directed strand as the template strand. Therefore, if following is the DNA sequence5’-CCG ATC GCA CAA-3’a) Using this sequence as template after transcription no protein can be translated. Why? I. Presence of start codonII. Absence of start codonIII. Due to mutationb) If you want to start the translation, what change you need in the second codon (from 5’ to 3’ direction)?I. Substitution of C with GII. No changeIII. Deletion of CIV. Both I & IIIarrow_forwardExplain why DNA is structually stable?arrow_forward
- In the DNA double-helix structure, the larger of the two grooves formed by the helical twist where certain base pairs are exposed is called the:arrow_forwardWrite the sequence of the DNA strand complementary to the following strand: AAATTTCGATCCCGGGAAATTTAGACCCGGGTTTAAACCCCGCATarrow_forwardYou have created a synthetic nucleotide, nucleotide X, which can be substituted into a DNA strand and is able to pair with C nucleotides. However, a C-X pairing is joined by a single hydrogen bond. If you were to create a DNA strand made with A, C, T and your new nucleotide X instead of G the new strand would... a) Denature at higher temperatures than a strand made with A, C, G, and T b) Expect helicase would have more difficulty separating these strands than strands made with A, C, G and T c) Denature at lower temperatures than a strand made with A, C, G, and T d) Not expect to see any differences in the physical properties of this DNA compared to DNA made with A, C, G and Tarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY