Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 5QP
Read the following experiment and interpret the results to form your conclusion. Experimental data: S bacteria were heat killed and cell extracts were isolated. The extracts contained cellular components, including lipids, proteins, DNA, and RNA. The extracts were mixed with live R bacteria and then injected together into mice along with various enzymes (proteases, RNAses, and DNAses). Proteases degrade proteins, RNAses degrade RNA, and DNAses degrade DNA.
Based on these results, what is the transforming principle?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What molecules are present in regions of gel corresponding to A?
What happens upon heatshock? What does Band B represent?
You are studying a bacterial metabolic pathway that results in the synthesis of a
product, vitalin, that is essential for survival.
In the figure below, each number represents an intermediate product, and each letter
represents the enzyme (protein) that catalyzes that step.
d
3
e
5
Vitalin
Compound
4 > Vitalin
You find that bacteria with mutations in either c orf can survive, but a bacterial cell
that has mutations in both c and f cannot survive.
Which of the following statements explain your observations?
Select all that apply.
If both genes, c and f, are mutated, then vitalin cannot be synthesized
O If gene c is mutated, then vitalin cannot be synthesized
The pathway to synthesis of vitalin is branched, and either one can result in
vitalin production
gene c is mutated, then bacteria can survive by synthesizing vitalin using
enzymes f and g
If
Briefly compare the composition of DNA versus that of RNA.
Answer the following questions pertaining to the experimental use of green fluorescent protein (GFP).
What is the main advantage of GFP in terms of protein visualization in cells/organisms? Which microscope technique is used to visualize GFP-tagged proteins?
Chapter 8 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 8.4 - Two genes associated with breast cancer, BRCA1 and...Ch. 8.4 - Prob. 2GRCh. 8 - What are Bruces options at this point? Bruce and...Ch. 8 - Should he reconsider and try chemotherapy instead?...Ch. 8 - Should he go ahead and enroll on the chance that...Ch. 8 - Until 1944, which cellular component was thought...Ch. 8 - Why do you think nucleic acids were originally not...Ch. 8 - Prob. 3QPCh. 8 - In the experiments of Aery, MacLeod, and McCarty,...Ch. 8 - Read the following experiment and interpret the...
Ch. 8 - Recently, scientists discovered that a rare...Ch. 8 - List the pyrimidine bases, the purine bases, and...Ch. 8 - In analyzing the base composition of a DNA sample,...Ch. 8 - The basic building blocks of nucleic acids are: a....Ch. 8 - Adenine is a: a. nucleoside b. purine c....Ch. 8 - Polynucleotide chains have a 5 and a 3 end. Which...Ch. 8 - DNA contains many hydrogen bonds. Are hydrogen...Ch. 8 - Prob. 13QPCh. 8 - State the properties of the WatsonCrick model of...Ch. 8 - Using Figures 8.7 and 8.9 as a guide, draw a...Ch. 8 - A beginning genetics student is attempting to...Ch. 8 - Chemical analysis shows that a nucleic acid sample...Ch. 8 - Prob. 18QPCh. 8 - RNA is ribonucleic acid, and DNA is...Ch. 8 - What is the function of DNA polymerase? a. It...Ch. 8 - Which of the following statements is not true...Ch. 8 - Make the complementary strand for the following...Ch. 8 - How does DNA replication occur in a precise manner...Ch. 8 - Nucleosomes are complexes of: a. RNA and DNA b....Ch. 8 - Discuss the levels of chromosomal organization...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following statements are true regarding the properties of DNA and RNA polymerase. Select all that apply. Both DNA and RNA polymerase synthesize nucleic acid strands in the 5" to 3' direction. Both DNA and RNA polymerase can initiate strand synthesis on their own. I. RNA polymerase initiates strand synthesis, while DNA polymerase depends upon an existing strand to continue synthesis. II. RNA polymerase only uses ribonucleotides for strand synthesis. DNA polymerase only uses deoxyribonucleotides for strand synthesis. V. Au DNA and RNA polymerases from eukaryotes behave very differently from DNA and RNA polymerases found in prokaryotes. O VI.arrow_forwardYou are studying a bacterial metabolic pathway that results in the synthesis of a product, vitalin, that is essential for survival. In the figure below, each number represents an intermediate product, and each letter represents the enzyme (protein) that catalyzes that step. 3 d>5'> Vitalin Compound –"> 1 '> 2 a 4 > Vitalin You find that bacteria with mutations in either c or f can survive, but a bacterial cell that has mutations in both c and f cannot survive. For every mutation, assume that the bacteria have other functional proteins in the pathway. Which of the following mutants can grow on media containing only intermediate 3? Select all that apply. O Mutant f Mutant b Mutant d Mutant carrow_forwardUsing the following coding DNA sequence:TAC GCA CCT TTA GAT CAT AAC TTT GGA ACT1. Write the complementary DNA sequence that would form the double helix: 2. Write the sequence of the mRNA transcript that would be produced from transcription (use the original sequence, not the complement you just wrote): 3. Now, using the mRNA transcript and the table, write the amino acid strand produced from translation:arrow_forward
- Shown below is a cartoon of a genetic oscillator. a) Convert into a Forrester diagram, state variables are D, m, E, S and P. As a reminder, dashed lines serve control/regulation. b) In a sentence, what causes the cyclic behavior in the formation of the product? DNA D mRNA Enzyme Substrate Product I 3arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: The term that refers to the synthesis of DNA using the information contained in RNA is called DNA replication STAMENT 2: The number of hydrogen bonds between guanine and cytosine is 3 ANSWER: STAMENT 1: If the %A of bacteria is 30%, then the % (G+C) of the bacteria is 40% STAMENT 2: The DNA is plectonemic because one of the strand go in 5’ to 3’ direction while the other go in the 3’ to 5’ direction ANSWER: STAMENT 1: DNA replication is conservative because one of the strands in the daughter DNA comes from the parent DNA STAMENT 2: In DNA replication, the strand copied into an mRNA is called the leading strand ANSWER:arrow_forwardPlease consider the figure below. a. Give the name of the process illustrated in the figure. b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B and/or C to answer the question. c. What type of enzyme is involved in the process described in (b)? d. What terminus of the protein is represented by label A?arrow_forward
- You study actin polymerization by monitoring the increase in fluorescence of pyrene-labeled actin. Pyrene is a fluorescent molecule, which has very low level of fluorescence on its own or when fused to G-actin. However, the pyrene fluorescence increases dramatically when pyrene-labeled G-actin is incorporated into a polymer. In this assay, the amount of pyrene fluorescence is proportional to the amount of actin polymer. In the figure below, actin polymerization curves resulted for conditions listed below; assume that G-actin concentration is above the critical concentration for the pointed end and that ATP is present. Which curve corresponds to which condition? Explainarrow_forwardIn this problem, just put the order of the intermediates on the pathway, starting with P and ending with Z and explain your reasoning. (So to get you started, notice the class 1 mutants—and there is only mutant in this class, which is mutant #5—won’t grow on minimal medium, but will grow if you give it substance Z. However, giving it substances, p, w, x, or y won’t help. This means that the gene that is mutated lies on the pathway in a place that the Z substances is to its right and all the other substances are to its left. The easiest next one to look at is the line with 2 pluses, and then the line with 3 pluses, and then the line with 4 pluses).arrow_forwardExperiment: Heat shock factors (HSF) are transcription factors that induce genes encoding proteins that protect against cellular stress. Two distinct heat shock factors, called HSF1 and HSF2, recognize the same binding site in DNA. The figure shows the result of an experiment in which the effect of an anti-inflammatory drug, indomethacin, was studied. HeLa cells were cultured at 37°C (lane 1 [C, control] and lanes 3-10), or 42° C (lane 2; HS, heat-shocked). The cultures for samples 3- 10 were treated with various concentrations of indomethacin, indicated at the top of each lane. After treatment, nuclear protein extracts were prepared and mixed with 32P-labeled, double- stranded oligonucleotides containing the HSF binding site. Anti-HSF1 (samples 7 and 8) or anti- HSF2 (samples 9 and 10) antibodies were also added to some of the samples. The samples were subjected to electrophoresis in a nondenaturing polyacrylamide gel, and autoradiography was performed.arrow_forward
- Transcribe the following DNA sequence. Then translate the resulting mRNA transcript. GGACTACGTTCAAAAGCCATGGATTCGGTA Transcription: Translation: What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.) a) nucleotide number 16 changes from a G to an A b) nucleotide number 12 changes from an A to a T c) nucleotide number 8 changes from a G to an A d) an insertion of a C between nucleotides 14 and 15.arrow_forwardIn the isolation of DNA, which of the following is the function of chilled ethanol? a. chelate the Mg2+ ions that are essential for the overall integrity of the cell membrane b. break down cell membrane thus releasing intracellular structure c. precipitate the nucleoproteins through salting-out d. retard the nuclease activity then precipitate the DNAarrow_forwardConsider the following DNA sequence: CATGTGTAGTCTAAA. Address the followin questions: AWrite the sequence of the DNA strand that would be replicated from this one. GTACACATCAGATT 2. White the sequence of the messenger RNA (MRNA) molecule that would be transcribed from the DNA strand. 30 GUACACAUCAGAU00 37 38 39 3. State how many codons the sequence specifies. 40 41 42 43 44 4. State how many amino acids the sequence specifies. 45arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license