Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: DNA sequence

A: This is defined as the process in which cells make proteins. This occurs in 2 stages which include…

Q: Directions: Transcribe the following strand into mRNA, then translate it into amino acids Example…

A: We'll see into one particular occurrence of this procedure here. A DNA sequence will be the…

Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…

A: The transcription of DNA produces mRNA. The process by which this mRNA is read by ribosomes, and a…

Q: in transcription, if the gene to be transcribed is 5’-ATCCGTGTAACCTT-3’, what is the sequence of the…

A: Transcription is the process that involves the synthesis of an RNA molecule from DNA. It is the…

Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…

A: Answer : glycine, proline, alanine, arginine,  The possible codons can be  CCG CGC GCC GGC GCG CGG

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Use this mRNA coding sequence as your starting point. This sequence begins with a start codon and…

A: The Central Dogma theory states that DNA makes RNA and RNA makes protein. DNA undergoes Replication…

Q: TACTGCCTCCCCATAAGAATT

A: Transcription is the process in which a gene's DNA sequence is copied (transcribed) to make an RNA…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5'…

A: DNA is double stranded & during replication both of its strands unwind to produce single…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: During translation elongation cycle, which of the following step(s) is/are repeated for each amino…

A: Translation is a process by which proteins are synthesized from mRNA template. It involves all the…

Q: The following DNA fragment was isolated from the beginning of a gene. Determine which strand is…

A: DNA, or deoxyribonucleic acid, is a molecule that carries the genetic instructions necessary for the…

Q: The sequence below is a template strand sequence for a gene (a very short one!). Identify the start…

A: DNA -> Transcription -> mRNA -> Translation -> ProteinTranscription is the synthesis of…

Q: Place sequences a, b and c into the correct order based on start and stop codons. Sequence A…

A: Introduction  Codons are units of genomic information made up of three nucleotides (trinucleotides)…

Q: For each of the following sequences, fill in either the DNA, the mRNA sequence, or the amino acid…

A: The given mRNA sequence: AUG ACU AGC UGG GGG UAU UAC UUU UAG  The corresponding DNA sequence will be…

Q: I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3…

A: The central dogma of molecular biology explains the flow of genetic information through the…

Q: Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use…

A: The genetic material of the cell contains various genes that code for various proteins. This happens…

Q: How many other codons apart from the one used could encode the last amino acid in this peptide (i.e.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A: The genetic code includes the information on DNA for the protein made from RNA, which is called gene…

Q: You are given the following mRNA sequence. You know that it contains some UTR sequence and the…

A: The mRNA Molecule as transcribed from DNA has some untranslated regions (UTRs) at both ends. That…

Q: The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1)…

A: At first you have to know about coding and non-coding strand. A coding atrand is a DNA strand that…

Q: Given the following DNA sequence of the template (i.e. noncoding) strand for a given gene:…

A: The double-stranded DNA molecule is made up of two DNA strands known as the template strand and the…

Q: If MRNA carries the code: UUU-UCG-ACU-GAU-GUU, then what is the corresponding code on the coding…

A: The mRNA or the messenger RNA is transcribed from the antisense or non-coding strand of the DNA as a…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: Where and for what reason (s) are you likely to observe the letter "N" in your Sanger sequence…

A: Sanger sequencing, also known as chain-termination sequencing, is a method for determining the…

Q: Below is a double stranded DNA that contains an ORF. Identify the ORF and in the spaces below, first…

A: DNA DNA is a genetic material from which amino acid sequence or polypeptide chain are made.

Q: A small section of MRNA codons has the following sequence: UGU GGU CAA CCG Some Amino Acids 1.…

A: Translation or protein synthesis is the third major step of the central dogma of life. mRNA…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…