Below is a double-stranded DNA: ATATGTGGTCTCGGTCCGTTAGGCAAT TATACACCAGAGCCAGGCAATCCGTTA   1. In this given DNA, the top strand is the 5' to 3' strand and the bottom strand is the 3' to 5' strand. The bottom strand (3' to 5' strand) acts as the template for transcription. PLEASE EXPLAIN WHY. 2. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript. 3. Identify the polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from.

Q: DNA MANNMANN B mRNA Transcription Transport to cytoplasm for protein synthesis (translation) Mature…

A: Introduction :- Protein synthesis is the process of creating proteins from amino acids inside live…

Q: Below is a sample of a segment of DNA…(copy from left to right)   3’…

A: Mutation  It occurs when a DNA gene is changed in such a way as to alter the genetic message carried…

Q: put in correct order the steps for initiating translation. 1. Binding of initiator tRNA to mRNA 2.…

A: The translation is the process by which cells make proteins. Here, the mRNA formed by transcription…

Q: ***10. Fill in the blanks to describe the similarities between transcription and DNA replication.…

A:

Q: Take each of the DNA sequences and complete ALL of the following steps: i. Find the DNA Replication…

A: A set of guidelines known as the genetic code controls how genetic information is converted from DNA…

Q: Choose the correct answer from the list. is a DNA binding site. protects coding sequences at the 5'…

A: All these terms are related to synthesis of biomolecules by the processes such as transcription and…

Q: 5'AGGCTCCAGG 3' Which complementary RNA strand can be made from this sequence? Select one: O a. 5'…

A: formation of m RNA from DNA is called transcription. RNA polymerase synthesizes m RNA by adding…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: During the elongation phase of transcription, how is RNA polymerase able to "read" the DNA sequence…

A: Transcription is the process by which the genetic information stored in DNA is copied into a…

Q: 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 -…

A: The base-pairing rule in DNA is that cytosine (C) pairs with guanine(G) and adenine (A) pairs with…

Q: Given an artificial mRNA consisting of a repeated dinucleotide (5'... GUGUGUGUGUGU... 3), match the…

A: A codon is a group of three DNA or RNA nucleotides that codes for a particular amino acid or protein…

Q: Below is the template DNA sequence for an entire (short) gene that contains no introns. TRANSCRIBE…

A: The Central Dogma of Biology  DNA --(Transcription)-- RNA --(Translation) -- Protein  It says that…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A nucleotide sequence in a segment of a DNA information strand is given here. Sketch (A) the…

A:

Q: Question / G 3 G2 G1 G 5 G 4 GGU AUG GCC AUG CUC CUc UUC ACG GAG UAC CGG R (the strand) Y CUC GAG…

A: In this image the process of transcription is shown where an mRNA is being translated with the help…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: The RNA is produced from the template strand of DNA by the transcription process that occurs within…

Q: 3' A TAT --IIL 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 DNA C GU UGA UG G MRNA TRNA Amino…

A:

Q: 1. Describe at least four ways in which transcription is different from DNA replication.

A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: 17. You are presented with the following DNA molecule: 5 ATGCGATTATAA 3' 3' TACGCTA ATATT5' A. Write…

A: Given: A DNA Molecule: 5' A T G C G A T T A T A A 3' 3' T A C G C T A A T A T T 5' DNA =>…

Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons.  How…

A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…

Q: 2a. Assume that replication has been initiated at that ORI. Provide the sequence of the primer that…

A: AT GC base pairing: In double stranded DNA, the guanine (G) base on one strand can form three…

Q: This activity will use the Human β-hemoglobin gene, which is mutated in sickle cell anemia, with the…

A: In order to provide good quality answers and keep with the site regulations, the first three parts…

Q: 3. Where in the eukaryotic cell does transcription during transcription? occur and what molecule is…

A: Nucleic acid is a macromolecule present inside the nucleus of the cell . In this , genetic material…

Q: 63 62 GI GS G4 GGU AUG GCC AUG CUC ACG GAG UAC CGG R (the strane CUC GAG AAG The original template…

A: the process shown in the picture above is is protein translation where protein is translated…

Q: A. DNA Replication Construct a DNA with 15 base pairs. (Note that the first three nucleofides of the…

A: DNA(Deoxy ribonucleic acid) is a double stranded helical structure which is made up of phosphate…

Q: The following non-coding sequence (i.e. template strand) is transcribed by the RNA pol II into a…

A: Identify the 5' and 3' ends of the DNA template strand.  Write down the complementary bases for each…

Q: Nitrous acid is a mutagen. It can react chemically with cytosine to change it to uracil in a DNA…

A: Nitrous Acid (HNO2) acts as a mutagen by deamination (removal of the NH 2 group) of adenine and/or…

Q: 5’ GGACCTATCAAAATCCTTATGCGCTAGGATAGCTAACGCATCCAC3’ This is the template strand. The +1 transcription…

A: Introduction :  One of the earliest steps in gene expression is transcription. The transfer of…

Q: What is the mRNA sequence of this DNA and in which direction will mRNA polymerase travel?

A: Messenger RNA is also known as mRNA is a single-stranded RNA molecule, which is complementary to one…

Q: Bēlöw is thế TEMPLATE strand of DNA for a particular gene. Template strand: 5' AATCАTAAСТСАТTG 3' A.…

A: The two types of strands in DNA are coding (non-template) and template (non-coding). Both strands…

Q: transcription process of a prokaryotic gene. Redraw the diagram and label parts (i) to (v) on the…

A: Since there are multiple questions in this particular question, I'll answer the first three subparts…

Q: Could you please answer the part of the question where they ask you to motivate your answers?

A: A transcription bubble is a chemical structure that forms when a little piece of the DNA…

Q: DNA Replication For the following piece of DNA, draw the replicated piece of DNA the original and…

A: DNA replication is a process by which one molecule of DNA replicates and results in two daughter DNA…

Q: If this was an eukaryote, what would you find in the leftmost cytosine? 5' Poly A tail 3' Poly A…

A: IntroductionIn eukaryotic mRNA, there are two important structures that are added to the ends of the…

Q: What is the sequence of the newly synthesize DNA segment if the template strand has the following…

A: A DNA refers to a helical structure that is made of nucleotides. A nucleotide comprises a phosphate…

Q: 29. Given the DNA sequence, please write the mRNA and then amino acid sequence.…

A: Amino acids are the organic compounds that contain both amino and carboxylic acid as their…

Q: . What is the nucleotide sequence of the complementary strand of the DNA molecule:…

A: DNA or deoxyribose nucleic acid is the genetic material for most organisms. It is a polymer of…

Q: After transcription begins, several steps must be completed before the fully processed mRNA is ready…

A: In eukaryotic cells, the process of gene expression involves several steps, beginning with…

Q: Decide whether the statement is TRUE OR FALSE. Justify your answer. Introns are coding regions of…

A: Gene and gene expression genes are the heredity units present on the chromosomes which further…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: I need help with a micro biology question involving DNA sequence and transcription. Below is a…

A: Given Template (antisense) DNA strand is:  3' -T A C T G A C T G A C G A T C -5' During…

Q: Explain why DNA replication must be primed by RNA.

A: Disclaimer: Since you have asked multiple questions, we will solve the first question for you. If…