Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find start foods in the picture

Q: Obj 29. Identify the specific terms applied to the process of protein synthesis described by each…

A: Epinephrine, also known as adrenaline, is a hormone and neurotransmitter that plays a critical role…

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…

A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…

Q: Which is NOT a modification made to pre-mRNA? addition of a 5' cap removal of introns addition of a…

A: In bacteria, RNA transcripts are ready to act as messenger RNAs and get translated into proteins…

Q: Depict the RNA transcript in the box below 5' - ATG GGG CCC GTT TTC AAT ATG CAG GTC CAT CCG TAC GTA…

A: DNA and RNA are all made up of nucleotides, which have a five-carbon sugar backbone, a phosphate…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: In a gene, the start codon is generally_ while the stop codon is generally Select an answer and…

A: When it comes to genomics, translation refers to the process through which instructions included in…

Q: Translate the following mRNA sequence into the appropriate amino acid sequence.…

A: Messenger RNA is referred to as mRNA. It is a specific kind of RNA (ribonucleic acid) molecule that…

Q: Figure out the mutation. You will need the codon table to answer this question. Wild type DNA…

A: DNA is two strand ladder like structure which consists of :-  A ) Coding strand  B ) Template strand…

Q: eukaryotic pre mrna processing occurs in the ___

A: Nucleus

Q: C T 3 11 G 5 A Hius) DNA coding (information) strand DNA template strand Synthesis of mRNA…

A: DNA stands for deoxyribonucleic acid, is a hereditary material, consisting of information related to…

Q: Below is an image of translation occurring in the direction indicated by the arrow. Use the image…

A: An arrow has been given that signifies in which direction, translation is happening. Translation…

Q: he question with gene sequence to predict amino acid sequence.

A: introduction  Translation is the process of translating the sequence of a messenger RNA (mRNA)…

Q: Which of the following processes occur on the mRNA during and/or after transcription but before…

A: Introduction  Gene expression is the process of activating a particular gene so that messenger RNA…

Q: T The template strand of a gene contains the sequence 3’- TTCAGTCGT-5’. Imagine that the nontemplate…

A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…

Q: A nontemplate strand of bacterial DNA has the base sequence 5'-ATGATACTAAGGCCC-3' Determine the…

A: The central dogma of molecular biology describes the flow of information in biological systems.  It…

Q: I keep getting this maked wrong, if you distinguish my mistake and explain to me in a deeper…

A: The translation is the process by which the genetic code encrypted in the mRNA gets converted to…

Q: MRNA contains contains O introns O exons both exons and introns

A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…

Q: Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence…

A:

Q: mulation Activity ctivity, you will be provided with the DNA nucleotide ce that codes for a…

A: DNA is a double helical molecule that helps in the transcription of mRNA which is eventually…

Q: Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of…

A: Transcription is the process by which the information in a DNA strand (template) is copied into a…

Q: Explain what is meant by the concept of "central dogma of molecular biology". Name the main…

A: An explanation of the movement of genetic information within a biological system is the core tenet…

Q: Figure out the mutation. You will need the codon table for this question. WT genomic sequence of a…

A: The mutation is simple known to state towards the   a term that  used to describe a change in the…

Q: Consider an image of an mRNA being translated. fMet Pro HAUG COCACG

A: In biology, "translation" refers to the second stage of protein synthesis, which is the process by…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Q: Eukaryotes have very different mRNA processing than prokaryotes do. Please check all that are…

A: Gene expression involves two processes that is- transcription and translation. Transcription is a…

Q: If you grow Trp R E.coli cells in a medium containing tryptophan, which of the following stem-…

A: The tryptophan binds to the trp repressor and causes it to change shape, converting into its active…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The gene is expressed from DNA into protein by Central Dogma. The transcription and translation…

Q: Can you explain the answer and how to find it ? Number 1

A: Any Change in the genetic material, which is not caused by recombination, tnat leads to altered…