add 9.9mL of sterile medium to give you a Dilution Tube #2. What is the concentrationof bacterial cells in Dilution Tube #1 and Dilution Tube #2?5. (ts). Here is a hypothetical gene showing the sequence of DNA nucleotides for thetemplate strand (note: the template strand is the strand that is transcribed). This sequenceincludes the regions that code for start and stop codons in translation as well asintrons and exons. The Introns are indicated by UNDERLINED NUCLEOTIDES.Coding Strand of DNA:+1Box2(-25)3' ....TATAAA........ TACTCGATAGCCGAATGTCTTC CTCAGACTAA... 5'a) Describe the role of the following in transcription of this DNA strand:a. RNA Polymeraseb. Promotersc. Transcription factorsd. Initiation, elongation and Termination of the pre-mRNA strandb) Transcribe the above DNA into a pre-mRNA Moleculec) You have just transcribed the above molecule of messenger RNA in the nucleus of ahuman cell. What types of modifications will occur to this RNA before it leaves thenucleus?d) Draw what the finished mRNA product will look like as it exits the nucleus.Translate the mRNA molecule into its final Amino Acid sequencef) Describe the process of Translation. Be sure to include details of Initiation, elongationand Termination, whole including discussion of:a.Ribosomesb. Ribosome binding sitesc. tRNAd. mRNA

Transcription is a process in which RNA is synthesized with the help of RNA polymerase enzyme. Later…

Answered: add 9.9mL of sterile medium to give you…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

You have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.
Part ii. ) please
Give detailed Solution with explanation
A plaque assay is performed beginning with 1 mL of a solution containing bacteriophages. This solution is serially diluted 4 times by combining 0.1 mL of each sequential dilution with 9.9 mL of liquid medium. Then 0.1 mL of the final dilution is plated in the plaque assay and yields 21 plaques. What is the initial density of bacteriophages in the original 1 mL? Recall that initial phage density = (plaque number/mL) ×× (dilution factor).
In E. coli, Base excision repair (BER) handles non-bulky lesions (e.g., deamination, oxidation) and nucleotide excision repair (NER) handles bulky lesions (e.g., Py dimers). Is this statement true or false? O True False
Droplet based single cell DNA sequencing uses a microfluidic platform which generates droplets encapsulating individual cells. A micrograph of such a device [Zilionis et al, Nature Protocols 2016] is presented in Figure Q3. The channels are 25 μm deep. (a) (b) Oil Figure Q3. Micrograph of the microfluidic droplet device. Scale bars are 100 µm. Adapted from Zilionis et al, Nature Protocols 2016. Red arrowheads show individual cells, and black arrows indicate flow direction. (c) RT/lysis reagents Cells Barcoding hydrogel beads A company wants to explore the design of a prototype of the device made from PDMS. Describe a suitable fabrication process, explaining the rationale behind each individual step. Schematics can be drawn to illustrate your response. You may want to refer to the datasheets at the end of the script. Testing of the prototype was successful and the company wants to explore the feasibility of manufacturing the device from glass. Describe the fabrication process for this…
We isolate DNA from a bacteria that is wild type for the genes arg leu and his shear it in a blender mix it into a culture of bacteria that is mutant for the genes arg leu and his . We then plate on various media. These are the results: Media with arginine 20 colonies /ml Media with histidine 300 colonies /ml Media with leucine 500 colonies /ml Media with all three 10000 colonies/ml 21. What is this experiment called? A. transpiration B. conjugation C. transformation D. transduction
#2 EcoRI --- 5’ G ↓AATTC 3’ 5’ ACG ACGTATTAGAATTCTTA TCCGCCGCCGGAATTCT CATCA 3’ 3’ TGC TGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:
Select all that apply from the following to each transformation process : The following are White non-glowing colonies White glowing colonies Blue non-glowing colonies Blue glowing colonies None of the above The transformation are: a. LB + kanamycin plates that have been spread with the E. coli cells transformed with your ligations, what phenotype of the colonies do you expect to obtain . b. LB + kanamycin plates that have been spread with the E. coli cells transformed with water, what phenotype of the colonies do you expect to obtain. c. LB plates that have been spread with the E. coli cells transformed with your pHSG298, what phenotype of the colonies do you expect to obtain. d. LB + kanamycin plates that have been spread with the E. coli cells transformed with PHSG298, what phenotype of the colonies do you expect to obtain. e. LB plates that have been spread with the E. coli cells transformed with your ligations, what phenotype of the colonies do you expect to obtain. f. LB plates…
A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained. Enzyme Fragment Size (kb) EcoRI 1.3, 1.3 Hpall 2.6 HindlII 2.6 ЕcoRI + Hpall ECORI + HindlII 1.3, 0.8, 0.5 0.6, 0.7, 1.3 (a) Is the original molecule linear or circular? (b) Draw a map of restriction sites (showing distances between sites) that is consistent with the data given. (c) How many additional maps are compatible with the data? (d) What would have to be done to locate the cleavage sites unambiguously with respect to each other?
None
Image 1. Which 2 primers from the choices provided would work to amplify the DNA sequence given below ? 5’ACTGAGTCCATGCGATCATGACTAT 3’ 3’TGACTCAGGTACGCTAGTACTGATA 5’ this is a hypothetical example. In a real experiment Choose 5’ TGAC 3’ 5’ CTAT 3’ 5’ ACTG 3’ 5’ ATAG 3’ Image2. the template strand?The results of a gel-based sequencing experiment are shown below. What is the sequence, written Only include nucleotides (no spaces or numbers )

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS