A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, polyadenylation sequence and a wildtype nucleotide sequence. However, the gene does not produce a functional protein List four reasons why this gene is not expressed in bacteria List five changes you recommend that allow expression of this eukaryotic gene in bacteria

A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, polyadenylation sequence and a wildtype nucleotide sequence. However, the gene does not produce a functional protein List four reasons why this gene is not expressed in bacteria List five changes you recommend that allow expression of this eukaryotic gene in bacteria

Name: A full-length eukaryotic gene is inserted into a bacterial chromosome.
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, polyadenylation sequence and a wildtype nucleotide sequence. However, the gene does not produce a functional protein List four reasons why

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domain
A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter, a wildtype nucleotide sequence and a polyadenylation sequence. However, the gene does not produce a functional protein. Part A: List up to five reasons why this gene is not expressed in E. coli. Part B: What changes do you recommend that would facilitate expression of the eukaryotic gene in E. coli.
Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very small gene. Transcription starts at nucleotide immediately following the promoter. The termination sequence is TATCTC. How many amino acids will this protein have? 5' TCATGAGATA GCCATGCACTA AGGCATCTGA GTTTATATCT CA 3' 3' AGTACTCTAT CGGTACGTGAT TCCGTAGACT CAAATATAGA GT 5'
The following double-stranded DNA sequence is part of a hypothetical yeast genome which contains a very small gene. Transcription starts at the Transcription Start Site (TSS), proceeds in the direction of the arrow and stops at the end of the Transcription Terminator (green box). 5' 3' TSS CTATAAAAATGCCATGCATTATCTAGATAGTAGGCTCTGAGAAATTTATCTCACT | | | | | | | | | | GATATTTTTACGGTACGTAATAGATCTATCATCCGAGACTCTTTAAATAGAGTGA - 5' PROMOTER TERMINATOR 3' a) Which strand (top or bottom) is the template strand? Explain why. b) What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends. c) What is the sequence of the protein produced from the mRNA? d) If a mutation (an insertion) were found where a T/A (top/bottom) base pair were added immediately after the T/A base pair shown in red, what would be the sequence of the mRNA? What would be the sequence of the protein?
Which of the following will result in an INCREASE in the levels (# of molecules) of the beta-galactosidase protein in bacteria? A mutation that disrupts the RNA coding region for lacZ A mutation that disrupts the promoter for the lac repressor (P+) A mutation that dirsrupts the RNA coding region for the lac repressor (lacl) A mutation that disrupts the lac protmoter (PL+) A mutaiton that disrupts the lac operator (OC) 00000
A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein. a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria. b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
IS. Alternative splicing has been estimated to occur in more than 95% of multi-exon genes. Which of the following is not an evolutionary advantage of alternative splicing? Alternative splicing increases diversity without increasing genome size Different gene isoforms can be expressed in different tissues Alternative splicing creates shorter mRNA transcripts Different gene isoforms can be expressed during different stages of development.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Gene X codes for a protein in eukaryotes. A mutated eukaryotic cell contains an altered base-pair in an intron of gene X. Which would be the most likely effect of this mutation on the biomolecules in the cell? The amount of pre-mRNA transcribed from gene X would be less than normal. The amount of functional protein corresponding to gene X would be less than normal. The ability of snRNAs to form a spliceosome would be diminished. The breakdown of mature mRNA corresponding to gene X would be faster
Provide a detailed description of gene expression and control in prokaryotes. Provide a detailed description of proteins critical for this process. (please hand draw a figure showing gene expression and control in prokaryotes and the proteins involved)
Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?