(a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located? Mark the area on the restriction map.
Q: A microbiologist discovers a new type II restriction endonuclease. When DNA is digested by this…
A: Restriction enzymes are also known as molecular scissors because they cut the DNA at specific, short…
Q: Explain your experimental approach if you must correct the genetic defect phenylketonuria, which is…
A: Phenylketonuria (commonly known as PKU) is an inherited disorder that increases the levels of a…
Q: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19?
A: Hello. Since your question has multiple parts, we will solve first question for you. If you want…
Q: A. A plasmid is shown with the locations of various restriction enzyme sites labeled. If you cut the…
A: if we cut the plasmid with XhoI and XbaI then we will get three fragments of following sizes 1000…
Q: On the gel shown below are four DNA samples. Samples A to C are taken from tissues of landslide…
A: The gel electrophoresis is used to separate the DNA fragments according to their sizes. The smaller…
Q: recombinant plasmid
A: DNA is the material that carries all the information about how a living thing will look and…
Q: The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b)…
A: Introduction: The genetic material in the living organism that transfer from one generation to…
Q: A small DNA molecule was cleaved with several different restriction nucleases, and the size of each…
A: A restriction map is a map of known restriction sites within a sequence of DNA. Restriction mapping…
Q: You are trying to clone a gene, You have successfully isolated it from the genomic DNA of an…
A: The term DNA cloning is associated with a process that plays an important role in making copies of a…
Q: You have a DNA sequence of 1800 bp. To characterize it, you decide to make a restriction map.…
A: Restriction mapping is a process that helps to determine the location of the restriction site. The…
Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point…
A: EcoR1 is a restriction enzyme that can cleave a dsDNA at the sequence GTTAAC. They cleave the cite…
Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…
A: in agarose gel electrophoresis we separate DNA bands based on their size.
Q: Table 21.3 describes the cleavage sites of five different restrictionenzymes. After these…
A: An enzyme produced from the bacteria which recognizes specific base sequence in DNA and cut the DNA…
Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…
A: It is related to molecular biology in which we use restriction enzymes an important tool for
Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…
A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…
Q: Choose the combination of answers that most accurately completes the statement.Which of the…
A: Restriction endonuclease or restriction enzyme is a type of enzyme used in cloning studies. It is…
Q: How many DNA bands would you observe in an ethidium bromide-stained electrophoresis gel if you…
A: In agarose gels and various cesium chloride gra- dient techniques, ethidium bromide is employed to…
Q: Your cloning vector has restriction recognition sites for two restriction endonucleases, EcorI and…
A: Introduction Recombinant DNA technology enables us to construct DNA using the Recombination method.…
Q: What do you mean by restriction fragments?
A: Recombinant DNA technology is the process of combining two or more DNA fragments from a different…
Q: Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites…
A: Restriction enzymes are specific endonuclease that can cut a DNA at a particular sequence.…
Q: What are two factors that will determine the frequency at which a restriction endonuclease cleaves…
A: Restriction enzymes are the type of enzyme that is used to cleave the DNA during the molecular…
Q: What is restriction fragment length polymorphism and which method do we use to detect it?
A: Restrictions length polymorphism (RFLP) is a kind of polymorphism that outcomes from variety in the…
Q: Consider a partial restriction digestion, in which genomic DNA is exposed to a small, limiting…
A: The process of cutting or cleaving DNA by using restriction enzymes is called digestion or…
Q: Identify the basic steps (in right order) in AFLP marker analysis. Explain briefly how this marker…
A: Basic steps in AFLP marker analysis.
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATT CCCGGTATA", what is its complementary…
A: DNA (deoxyribonucleic acid) is a double-stranded nucleotide sequence that is intertwined and…
Q: What are the sticky ends of the restriction fragments? Select one: a. The surfaces of sticky ends…
A: In molecular biology , Restriction endonuclease are the enzymes that helps in splitting the DNA and…
Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…
A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…
Q: molecular scissors", justify that
A: Restriction enzymes are found in a wide variety of prokaryotes. Restriction enzymes received their…
Q: The restriction enzymes KpnI and Acc65I recognize and cleave the same 6-bp sequence. However, the…
A: To answer this question we should have knowledge of Biotechnology
Q: You have another circular plasmid. Complete and effective digestion of this plasmid with a…
A: The restriction enzymes are endonuclease that means they can cut the DNA from the middle. They are…
Q: The gene you are asked to clone is 30,000 bps in length. When you are choosing a suitable…
A: Introduction Enzymes are the crucial biomolecules which assists in various biochemical reactions…
Q: The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that…
A: Answer :- In Sanger manual sequencing, DNA of interest is amplified along with dye-labeled chain…
Q: What is a restriction digest? What does it mean if you were given a precut DNA?
A: Restriction enzyme digestion takes advantage of naturally occurring enzymes that cleave DNA at…
Q: f restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…
A: Nucleases are enzymes that degrade nucleic acids. They can be classified into RNase : enzymes…
Q: If you are a genetic engineer and you cloned your gene of interest in a plasmid and you want to know…
A: Answer. Blotting describes the immobilization of sample nucleic acids/proteins onto a solid support.…
Q: If the Hinfl restriction enzyme recognizes G^ACTC sites, as seen in the image, belUW. GACTC How many…
A: The cloning of DNA is the mechanism by which a certain fragment of DNA is multiplied. The selected…
Q: A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid…
A: Plasmids are small, circular, double stranded, and extrachromosomal bacterial DNA. i.e. it is…
Q: U have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the…
A: A restriction endonuclease or restriction enzyme is a bacterial enzyme that cuts dsDNA into…
Q: Restriction endonuclease and ligase are two types of enzymes used in the process of genetic…
A: DNA stands for deoxyribonucleic acid. It is the genetic material of the organisms that transfer from…
Q: Table 1 shows a list of restriction endonucleases with their recognition sequence and the sites of…
A: Restriction enzymes are those that cleave the double stranded DNA at specific site. They have…
Q: sequence? Which enzyme will cut this sequence and where in the sequence? What is the sequence of the…
A: Given: Need to find the recognition sequence and sequence of the 'sticky end' produced by this…
Q: If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say…
A: *If the GAATTC palindrome repeats found along the DNA strand then some sizes of the fragments that…
Q: A 22-kb piece of DNA has the following restriction sites:A batch of this DNA is first fully digested…
A: The restriction enzymes clean the nucleotide fragment at specific sides called the restriction…
Q: Please answer both parts, a. The enzyme that catalyzes the joining of fragments to form recombinant…
A: The recombinant DNA technology is a branch of biology that deals with different techniques that…
Q: If you use the pUC18 vector to clone in the MCS region, predict the following: a) Do bacteria that…
A: pUC18 [plasmid of the University of California], is a bacterial plasmid that was derived from pBR…
Q: If restriction endonucleases are produced by bacteria within a host, why don’t these enzymes chew up…
A: Introduction A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that…
Q: You are trying to clone a gene. You have successfully isolated it from the genomic DNA of an…
A: Gene cloning is a process to form multiple copies of desired DNA of interest. This is done to- * to…
Q: A small DNA molecule was cleaved with several different restriction nucle- ases, and the size of…
A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is the…
Q: If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction…
A: The restriction enzymes are responsible for cutting the double stranded DNA molecules at specific…
Q: The total size of the plasmid is 2686 bp. There is a PstI recognition site at position 439, HindIII…
A: Answer - d. 3 fragments: 447bp, 507bp and 1732bp
Q: How does that length compare to that of restriction enzymes? Implications?
A: Answer- Restriction enzyme is also called as molecular sisscors because it is used to cut the DNA…
Q: Will you please help me in understanding these? How many fragments will be formed after…
A: "Since you have asked multiple questions, we will solve the first three questions for you. If you…
Q: What are the three types of DNA ends that can be generated after cutting DNA with restriction…
A: A restriction enzyme, also known as a restriction endonuclease, is a bacterial protein that cleaves…
Q: The restriction enzymes Kpn I and Acc 65I recognize and cleave the same 6-bp sequence. However, the…
A: Introduction: Enzymes are proteins that serve as biological catalysts and increase the rate of the…
Q: How many fragments would you expect to be formed from digestion of a 2500 base pair long linear…
A: Given information: 2500 base pair long linear piece of DNA is the piece of DNA that is to be worked…
he gel presented here shows the pattern of bands of fragments produced with several restriction enzymes. (a) From your analysis of the pattern of bands on the gel, draw the correct restriction map and explain your reasoning. (b) The highlighted bands (magenta) in the gel hybridized with a probe for the gene pep during a Southern blot. Where in the gel is the pep gene located?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 1 images
- 4.08 H H 1.02 2.54 11.021 E E Note: 1.67 = EXON = INTRON E 10.8 kbp 3.94 3.66 E = EcoRI site H = Hindill site H 0.81 EE 1.76 1.10 Fragment sizes are not to scale and all fragment lengths are in kilobase pairs (kbp) Draw the appearance of the autoradiogram of the Southern blot after hybridization with a cDNA probe. IHomologous Recombination, Heteroduplex DNA, and Mismatch Repair Homologous recombination in E. coli leads to the formation of regions of heteroduplex DNA. By definition, such regions contain mismatched bases. Why doesn’t the mismatch repair system of E. coli eliminate these mismatches?Heteroduplex DNA Formation in Recombination From the information in Figures 28.17 and 28.18, diagram the recombinational event leading to the formation of a heteroduplex DNA region within a bacteriophage chromosome.
- Given the following double-stranded fragment of DNA: 5'- ACTTGGCAGGCCTTCGATCC-3' 3'- TGAАССGTCСGGAAGCTAGG-5' A hypothetical restriction endonuclease recognizes a 6bp sequence with two-fold symmetry (typical for restriction enzymes) found in this fragment and catalyzes cleavage of this DNA on both strands between GG nucleotides within the recognition sequence. This nuclease exhibits b-type cleavage (atypical for restriction enzymes). Draw the double-stranded sequence of each fragment after cleavage showing any phosphates left on the ends.A number of yeast-derived elements were added to thecircular bacterial plasmid pBR322. Yeast that requireuracil for growth (Ura− cells) were transformed withthese modified plasmids and Ura+ colonies were selected by growth in media lacking uracil. For plasmidscontaining each of the elements listed in parts (a) to(c), indicate whether you expect the plasmid to integrate into a chromosome by recombination, or insteadwhether it is maintained separately as a plasmid. If theplasmid is maintained autonomously, is it stably inherited by all of the daughter cells of subsequent generations when you no longer select for Ura+ cells (that is,when you grow the yeast in media containing uracil)?a. URA+ geneb. URA+ gene, ARS c. URA+ gene, ARS, CEN (centromere)d. What would need to be added in order for these sequences to be maintained stably in yeast cells as alinear artificial chromosome?1)Explain why there is a part of the Lacz gene in pUC18119 and also how the natural biochemical process wherein it normally functions is used during cloning by molecular biology. 2)Write down the basepairs of double-stranded ONA that is generated at the joint between a plasmid that is digested with Xhol and a DNA fragment that is digested with Sall and joined by DNA-ligase. Indicate the 5'- and 3'- termini of each strand.
- To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?28. In a transformation experiment, DNA is collected from an E. coli donor strain of genotype cys(+) leu(-) thr(+) and used to transform a recipient of genotype cys(-) leu(+) thr(-). Initially, the treated recipient population is plated on a minimal medium supplemented with threonine. Many colonies are obtained. What are possible genotypes of these colonies? A. cys(-) leu(+) thr(+) B. cys(+) leu(+) thr(-) C. All are cys(+) and either + or - for leu and thr D. All are thr(+) and either + or - for cys and leu E. All are thr(-) cys(-) and either + or - - for CYSA cloned Bam HI DNA fragment, 3.0 kb long, was isolated in preparation for sequence determination. First, a map of restriction endonuclease cleavage sites had to be prepared. Cleavage by each of the indicated enzymes generated fragments of the sizes shown on the three agarose electrophoresis gel figures below; the gels are running from top to bottom. On the diagram below those, show the relative positions of EcoR I and Hpa II cleavage sites and the distances (in kb) between them. Explain your reasoning – is your placement of the cleavage sites the only one that will work?
- Given the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…What is the actual biological purpose of the CRISPR/Cas9 system? 9.2. Explain the fundamental difference between CRISPR/Cas9 and in vivo adenovirus-based gene therapy Explain why there is a part of the LacZ gene in pET32a(+) and also how the natural biochemical process wherein it normally functions is used during cloning by molecular biology.Section Name MAPPING PRACTICE #4 Plasmid pBR 607 is a 2.6 Kb plasmid containing Ampicillin and Tetracycline resistance markers, an origin of replication, and unique restriction sites for the restriction enzymes EcoRI, BamHI, and Pstl. Given the restriction map for pBR 607 for the enzymes EcoRI, BamHI, and Pstl, show on the gel diagram, where the approximate positions of the restriction fragments generated from the restriction digests would be located after carrying out electrophoresis. BamHI 0.2 Kb pBR 607 ECORI 1.94 Kb 0.46 Kb Pstl Size EcoRI EcoRI EcoRI + Standards BamHI + Pstl BamHI Pstl 4.0 Kb 2.2 Kb 2.0 Kb 0.5 Kb