A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?
Q: So the spliceosome is a structure that allows RNA splicing to occur, expelling the introns. Does…
A: spliceosome is a RNP complex found in eukaryotic Nucleus and is responsible for removal of introns…
Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNA…
A: The process in which eukaryotic ribosome selects its start codon is a part of translation.…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: RNA splicing is the process of removal of non coding sequences called as introns and joining of…
Q: The gene for triose phosphate isomerase in maize (a corn plant) spans over 3400 base pairs of DNA…
A: The post-transcriptional modifications are observed during the processing of other transcripts which…
Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…
Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…
A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…
Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…
A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…
Q: For each of the following initiation factors, how would eukaryoticinitiation of translation be…
A: Initiation factors are a kind of proteins, which bind to the smaller subunit of the ribosome. This…
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: Translation is the process of formation of protein using the information encoded in the mRNA. mRNA…
Q: What is the peptide encoded by this mRNA sequence 5’-UCG-GCA- AAU-UUA -GUU-3’?
A: m-RNA consist of 5' to 3' direction as it is synthesized from the dna template in the 5' to 3'…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UUA -GUU-3
A: RNA (Ribonucleic acid) polymerase is the major enzyme responsible for the transcription process in…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…
A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…
Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…
A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: The translation is a process in which the transcribed messenger RNA (ribonucleic acid) is decoded by…
Q: The length of a particular gene in human DNA, measured from the start site for transcription to the…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: In eukaryotic cells, mRNAs have been found to have a circular arrangement in which proteins hold the…
A: In the context of cell biology, the rate of mRNA translation into cellular proteins called…
Q: EF-Tu, a member of the G-protein family, plays a crucial role in the elongation process of…
A: Protein synthesis is a process through which genes in the DNA are transcribed into mRNA and through…
Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…
A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…
Q: With in vitro translation of an RNA into a polypep-tide chain, the translation can begin anywhere…
A: A cell "reads" the information in a messenger RNA (mRNA) during translation and uses it to create a…
Q: When glycoproteins are synthesized in the cell, at what stage of the polymerization of the protein…
A: Proteins with covalently linked sugar residues are known as glycoproteins. Sugars' hydrophilic and…
Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…
A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…
Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…
A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…
Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…
A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…
Q: I only need letter D and E
A: There is a group of three bases in an mRNA. This group of three bases comprises a codon. Each codon…
Q: peptide bonds between adjacent amino acids requires peptidyl transferase enzyme activity, which is…
A: The enzymatic activity of ribosome is called as peptidyl transferase activity. The site of catalysis…
Q: EF-Tu, a member of the G-protein family, plays acrucial role in the elongation process of…
A: Translation or protein synthesis is the process by which the genetic information from DNA is passed…
Q: Which of these statements is true about the elongation step of translation? O The growing…
A: ANSWER;- The small ribosomal subunit detaches and reattaches every time a new amino acid is…
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: Translation is the process of translating a messenger RNA (mRNA) molecule into the amino acid…
Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…
A: The central dogma of life involves three major steps that include: DNA replication: This is the…
Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?
A: m-rna is synthesized in 5' to 3' direction and it used the enzyme rna polymerase and dna template…
Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…
A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…
Q: . What is the minumum number of tRNA molecules that a cell must contain in order to translate all 61…
A: The three consecutive nucleotides on messenger ribonucleic acid from codon. The codon sequence…
Q: Why does a bacterial mRNA bind specifically to the small ribosomal subunit?
A: The ribosome is a very complex structure, whose machinery is broadly divided into larger and smaller…
Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…
A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…
Q: eliminating the intron RNA immediately after it is excised from the pre-mRNA?
A: As we know that, the process of removing the introns and rejoining the coding section or exons ,of…
Q: How would a null mutation in the guanylyl transferase gene affect overall mRNA stability in…
A: RNA guanylyltransferase is known as a capping enzyme. It catalyzes the transfer of GMP from GTP to…
Q: Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense…
A:
Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…
A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…
Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…
A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…
Q: Are the 5′ untranslated regions (5′ UTR) of eukaryotic mRNAs encoded by sequences in the promoter,…
A: The 5′ UTR is located in the first exon of the gene.
Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…
A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…
Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…
A: Introduction The central dogma of molecular biology describes the flow of genetic information from…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?
![](/static/compass_v2/shared-icons/check-mark.png)
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Sickle cell anemia is a widespread disease in many African countries and can be caused by a change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with the disease and a genetic fingerprint reveals the following DNA sequence for the gene: (a) (b) (c) (d) (e) Write down the mRNA sequence for the given DNA sense strand indicating the polarity. Derive the polypeptide from the mRNA molecule using the table of the genetic code (Table Q1 below) again indicating the polarity of the peptide chain. Indicate the position in the DNA molecule that could have caused the disease and write down all possible point mutations in the DNA sequence that could have caused it. [ The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write down all possible t-RNA molecules with their anti-codons that are used to polymerize the amino acid VAL. Indicate the polarity. 3'-TAC TGA GCA AGA TTA CAT ACT-5' Explain what is meant by redundancy of the genetic code.…The pioneer round of translation of an mRNA is very important to identify potentially dangerous mRNAs if per chance they possess aberrant in frame translational stop codons. Their detection leads to rapid degradation through the NMD pathway. What indications would the cell use to signal that an mRNA possesses an in frame stop following the pioneering read? Choose one. a) The mRNA has a shorter Poly A tail since it is not being efficiently translated b) If the cap binding protein is no longer associated with the cap it signals to the cell that the mRNA is no longer translatable. c) A stalled ribosomal complex on the mRNA is clearly detectable and since the translational machinery cannot initiate protein synthesis it is recognized as toxic and is degraded by the 26S proteasome. d) If the mRNA contains intron sequences then it is quickly recognized by the ribosomes as being abnornal and is degraded rapidly by the 26S proteasome. e) mRNA species that are still bound by key factors that…In EUKARYOTIC translation, how does initiation of translation occur? a) What components of the mature mRNA are involved (2 components) and b) what proteins are involved (at least 2 proteins)?
- Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code tableThe following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'
- Assume 102 nucleotide pairs of DNA to be responsible for transcription of particular mRNA molecule. What is the length of that mRNA in (1) angstrom? (2) in micrometers?The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known repeating sequences were used as mRNAs to direct protein synthesis in cell - free extracts . What type or types of polypeptides would you expect to be synthesized if poly (AAG) n (A) AAGAAGAAG ) used as the template for in vitro peptide synthesis ?Consider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?
- a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…The following questions refer to this diagram of a mature mRNA. 1) Which two sequences shown in the diagram are NOT directly transcribed from the template strand of DNA for this mRNA? ( select all that apply) a) The exons b) 5' cap c) 3' poly-A tail d) UGA e) AUG 2) Which of the following is/are a role for the poly-A tail? (Select all that apply.) a) Facilitates transport of the transcript out of the nucleus b) Confers stability to the mRNA c) Binds to RNA polymerase to initiate transcription d) Facilitates binding to DNA Identify the different regions of the mature mRNA by matching terms with regions. regions are shown in the second image terms: poly-A-tail 5'UTR 3'UTR coding sequence 4) Identify alternative splicing variants of this transcript, NOT including the original unspliced variant. (Select all that apply.) a) Exon 1, Exon 3, Exon 4 b) Exon 1 and Exon 4 c) Exon 1, Exon 2, Exon 4 d) Exon 2, Exon 3,…The genetic code was solved partly by the use of in vitro systems to translate synthetic RNAs into peptides. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. AAA = Lys; AUA = Ile; AAU = Asn; UAA = stop. What peptides would NOT be produced in an in vitro system if the following oligonucleotide were added: AAAAAAAAAUAAAAAAAA Select one: a) Lys-Lys-Lys-Lys-Lys-Lys-Lys-Lys b) Lys-Lys-Ile-Lys-Lys c) Lys-Lys-Asn-Lys-Lys
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)