4. The following data shows four amino acids found across three species. Which phylogenetic tree best represents the information in the chart? Species Manatee Amino Acid Sequence Arg - Lys - His - Lys

Q: How many 3 base sequences are in the Genetic Code? 12 20 22 64

A: The DNA code is read by the cell in three-base groups. Each codon, or triplet of bases, determines…

Q: 5. Which of these CANNOT result in evolution? O Mutations O Natural selection OSmall population size…

A: Evolution is a steady phenomenon that brings about change and alter life from simplex to more…

Q: 16. Study the table below. Organism Pair Percentage of DNA Similarity A-B 97 A-C 85 A-D 50 a. To…

A: Sequence Homology The sequence of homology is defined as the similarities between the DNA sequence…

Q: Proteins that share significant amino acid similarity are called ______.    ________ are related…

A: Large, intricate molecules called proteins carry out a variety of essential bodily tasks. They are…

Q: platypus is one of a very small number of mammals that are venomous. Researchers compared the…

A: Most important part in this paragraph is that the two proteins are almost similar in function and…

Q: What highly conserved molecule does bioinformatics compare among different species to provide…

A: There are various biomolecules in the form of Carbohydrates, DNA, RNA, proteins and fats. Out of…

Q: All organisms share a common coding system for their genomic information. The common features of…

A: The sum of all biological mechanisms by which certain features are passed down from parents to their…

Q: The "molecular clock" of the rate of change in a segment of DNA during evolution depends on which of…

A: The objective of the question is to identify the factors that influence the rate of change in a…

Q: All of the species investigated in the first two questions are land plants, and so they share a…

A: House keeping genes are defiens as the genes that are constitutively expressed across different…

Q: Which of the following statements is true about consensus sequences in DNA? Group of answer choices…

A: Short nucleotide segments which recur often in conserved sequences are known as consensus sequences.…

Q: AKS 5a: Use the table below to answer the question that follows. What is the approximate percentage…

A: DNA or deoxyribonucleic acid is the double stranded DNA that contains sugar and phosphate backbone…

Q: Which of the following is true? Group of answer choices All prokaryotes have a common genetic code,…

A: The amino acid sequence of proteins is determined by the sequence of nucleotides in deoxyribonucleic…

Q: Exon shuffling can readily produce new functional genes because it:     Converts exons into…

A: Exon shuffling is a molecular mechanism that may cause the evolution of new genes. It involves the…

Q: Here are the first eighteen positions of DNA sequence alignment, taken from a gene shared by the six…

A: Introduction  A species is an organism's fundamental unit of classification, taxonomic rank, and…

Q: The template strand of a gene has the sequence 5' CTAGTTGGCACACTCCATGGT 3'. Starting from the start…

A: The nucleic acids DNA and RNA are found in all living things. The deoxyribose nucleic acid is DNA,…

Q: Based on the information above, what can you speculate about the possible evolution of the genes…

A: Rab proteins are small GTP-binding proteins within a superfamily of GTPases known as the Ras…

Q: Report the differences you've observed between the nucleotide sequences of the different species in…

A: The process by which species adapt to their environment over time is called evolution. The…

Q: When comparing evolutionary similarities between different genes within a gene family, it is usually…

A: A gene is a sequence of DNA that codes for a specific protein. Proteins are the building blocks of…

Q: . (07.07 HC) Darwin explored the Galapagos Islands and observed variations of certain species. For…

A: Detailed explanation:  1. Each species has a different reproductive mechanism: This relates to…

Q: 22. You are studying variation in a human disease gene worldwide. You suspect that the disease is…

A: The alleles are given in the three population French, Melanesian, Yoruba and the alleles are in TT,…

Q: ) Poly A headdress and tail b) Ligase and helicase c) Amino acid and nitrogenous base

A: In eukaryotes, poly(A) tails usually act as stabilizers of intact mRNAs, whereas in E. coli they…

Q: Which of the following graphically shows the evolution of protein sequences? O Blosum-62 BLAST O…

A: Protein Sequencing:  Protein sequencing is the technique of determining the amino acid sequence of a…

Q: a rice species low high diverged six five whole genomes gene families homologous genes Duplication a…

A: Gene:  The term "gene" has a variety of meanings in biology. The molecular gene is a sequence of…

Q: 101. As discussed in lecture, recent studies of Neanderthals' nuclear DNA indicates that…

A: A biomolecule or biopolymer called deoxyribonucleic acid (DNA) is a nucleic acid that is found in…

Q: wo genes that evolved from the same common ancestral gene, but are now found as homologs in…

A: Gene is the functional and basic unit of heredity, made up of DNA. Every organism is composed of…

Q: a) Let's say the two motif hits (CCACGAG and CCGCCAG respectively) turn out to be evolutionarily…

A: Motifs are mainly short, conserved sequence patterns that are associated with specific function of a…

Q: Count the instances where there is any difference in the amino acid in the alignment of the six…

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: different uses of either version of the tree, what information does one impart that the other does…

A: Dendrogram: This is a collective term covering all types of phylogenetic trees whether they are…

Q: SEQUENCE 28 SEQUENCE 21 SEQUENCE 22 SEQUENCE 23 SEQUENCE 24 SEQUENCE 25 SEQUENCE 26 SEQUENCE 27

A: A phylogenic tree represents the evolutionary relationship between species or even proteins. The…

Q: In the table below, the letters represent amino acids that make up a polypeptide found in all the…

A: According to the question, in the table, the letters represent amino acids that make up a…

Q: Consider the multiple sequence alignment for a polypeptide below. Which of the eight amino acid…

A: Biomolecules such as proteins play a very important role in catalyzing biochemical reactions. They…

Q: Gene 3: Gene 3: Gene 4: Gene 4: Gene 5: Gene 5: Gene 6: Gene 6: Gene 7: Gene 7: Gene 8: Gene 8: Gene…

A: The DNA sequence will be transcribed into mRNA that contain the genetic codon by the process of…

Prokaryotic evolution

The term evolution means the gradual change or a transformation from a simple or primitive state to a complex or advanced state. Prokaryotic evolution is a concept that involves the evolution of the form and function of most primitive organisms (prokaryotes) through several stages and changes to form diverse life as a part of organic evolution.