22. You are studying variation in a human disease gene worldwide. You suspect that the disease is caused by a missense mutation of the codon TCC to CCC in some individuals. You use a microarray to assay the genotype of individuals at the polymorphic site, and find the following numbers of each genotype in in 3 different populations Population TT count TC count CC count French 42 49 Melanesian 10 40 50 Yoruba 4 32 64 What is the frequency of the T allele in each population? a. French: 0.09; Melanesian: 0.1; Yoruba: 0.04 b. French: 0.3; Melanesian: 0.3; Yoruba: 0.2 c. French: 0.3; Melanesian: 0.4; Yoruba: 0.3 d. French: 0.7; Melanesian: 0.7; Yoruba: 0.8 e. French: 0.1; Melanesian: 0.2; Yoruba: 0.3

22. You are studying variation in a human disease gene worldwide. You suspect that the disease is caused by a missense mutation of the codon TCC to CCC in some individuals. You use a microarray to assay the genotype of individuals at the polymorphic site, and find the following numbers of each genotype in in 3 different populations Population TT count TC count CC count French 42 49 Melanesian 10 40 50 Yoruba 4 32 64 What is the frequency of the T allele in each population? a. French: 0.09; Melanesian: 0.1; Yoruba: 0.04 b. French: 0.3; Melanesian: 0.3; Yoruba: 0.2 c. French: 0.3; Melanesian: 0.4; Yoruba: 0.3 d. French: 0.7; Melanesian: 0.7; Yoruba: 0.8 e. French: 0.1; Melanesian: 0.2; Yoruba: 0.3

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter17: Metabolism: An Overview

Section: Chapter Questions

Problem 13P: What Art the Features of the Series of -omes? Define the following terms: a. Genome b. Transcriptome...

See similar textbooks

Related questions

Q: the TPOX allele with the structure [TAGA]10 will be ______ nucleotides longer than the allele with…

A: [TAGA]10 will have four nucleotides longer than the allele with the structure [TAGA]5

Q: 15) Once researchers identified DNA as the molecule responsible for transmitting heritable traits,…

A: Information transfer is fundamental to all living organisms. For TWO of the following examples,…

Q: The length of the SURF1 gene is 15, 914 bases. This gene is comprised of 11 exons and 10 introns.…

A: Ans. The gene has specific sequences which are important for the transcription of the gene. One of…

Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…

A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…

Q: BOTTOM The sequence depicted on the gel is 5'-GTGATGTAG-3' The sequence depicted on the gel is 3'-…

A: This method is used for DNA sequencing and it relies on the use of Deoxyribonucleoside…

Q: Using the figure and the following background information answer the following questions about the…

A: Within the field of genetics and genomics, deciding the hereditary causes of certain characteristics…

Q: Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20…

A: After performing sequencing through gel electrophoresis DNA fragments are organized according to…

Q: If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and…

A: Escherichia coli or E.coli is determined as a type of bacteria that resides in your intestines. It…

Q: . Below are the DNA sequences that encode the first eight amino acids for five alleles of the Adh…

A: DNA (deoxyribonucleic acid) is the genetic material present in most organisms. The segment of DNA…

Q: In a transformation experiment, donor DNA was obtained from a prototroph bacterial strain (x* y z'),…

Q: How many markers of the genome are significantly associated with the trait?

A: In Monster Land, a population of 9-armed, hairy monsters displays Purple, Yellow, or mixed colors.…

Q: Write the complementary sequence for the following DNA sequence, in order from 3' to 5': Use all…

A: Note that in determining the complementary of a DNA sequence, always remember that adenine (A) pairs…

Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…

A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…

Q: State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change…

A: As per the guidelines we are supposed to answer only the first question In case of multiple question…

Q: The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome…

A: Bacteria are a prokaryotic microbe which have undefined nucleus and nuclear membrane. Bacterial…

Q: A family consisting of a mother (M), father (F) and their four children (C1-C4) were all genotyped…

A: Introduction: A collection of members of the same species, Homo sapiens, who live in one location or…

Q: I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1:…

A: DNA sequence variations among members of a population are referred to as genetic variation. Germ…

Question

100%

22. You are studying variation in a human disease gene worldwide. You suspect that the disease is
caused by a missense mutation of the codon TCC to CCC in some individuals. You use a microarray
to assay the genotype of individuals at the polymorphic site, and find the following numbers of each
genotype in in 3 different populations
Population
TT count
TC count
CC count
French
42
49
Melanesian
10
40
50
Yoruba
4
32
64
What is the frequency of the T allele in each population?
a. French: 0.09; Melanesian: 0.1; Yoruba: 0.04
b. French: 0.3; Melanesian: 0.3; Yoruba: 0.2
c. French: 0.3; Melanesian: 0.4; Yoruba: 0.3
d. French: 0.7; Melanesian: 0.7; Yoruba: 0.8
e. French: 0.1; Melanesian: 0.2; Yoruba: 0.3

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Similar questions

Shown below are eight DNA sequences from different individuals. Q.Give the haplotype of each sequence by listing the specific bases at each variable position in that particular haplotype.
che World Mona L A Leonardo da Vinci Museum - Flo x dSequenceViewer/14003927urlahttps%3A%2F%2F43160dd0-1a11-43d1-b28d-96e9e2abb6d2.sequences.api.brightspace.com2F1400392%2Factivity2217 1.07 Quiz: Experimentation UIZ: Experimentation Kate gathered three boxes of the same size made of different materials glass, clear plastic, and aluminum painted black She placed them on a window sill in the sun for an hour and then measured the warmth of the air in each box In this experiment, what is the warmth of the air? O an independent variable O a control O a constant O a dependent variable 2 3 45 Next
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
What is a contig?
1. There are two different variations at STR locus THO1. Where did these variations come from? b) The STR locus D21S11 only has one variation. Why?
The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them.
Shown below are eight DNA sequences from different individuals QHow many different haplotypes (sets of linked variants) are found in these eight sequences
6. A diploid strain of yeast was made by mating a haploidstrain with a genotype w−, x−, y−, and z− with a haploidstrain of opposite mating type that is wild type for thesefour genes. The diploid strain was phenotypically wildtype. Four different X-ray-induced diploid mutantswith the following phenotypes were produced fromthis diploid yeast strain. Assume a single new mutation is present in each strain.Strain 1 w− x+ y− z+Strain 2 w+ x− y− z−Strain 3 w− x+ y− z−Strain 4 w− x+ y+ z+When these mutant diploid strains of yeast go throughmeiosis, each ascus is found to contain only two viablehaploid spores.a. What kind of mutations were induced by X-rays tomake the listed diploid strains?b. Why did two spores in each ascus die?
2. please answer this
Nine rII− mutants of bacteriophage T4 were used inpairwise infections of E. coli K(λ) hosts. Six of themutations in these phages are point mutations; theother three are deletions. The ability of the doubly infected cells to produce progeny phages in large numbers is scored in the following chart.1 2 3 4 5 6 7 8 91 − − + + − − − + +2 − + + − − − + +3 − − + − + − −4 − + − + − −5 − − − + +6 − − − −7 − + +8 − −9 −The same nine mutants were then used in pairwise infections of E. coli B hosts. The production of progenyphages that can subsequently lyse E. coli K(λ) hosts isnow scored. In the table, 0 means the progeny do notproduce any plaques on E. coli K(λ) cells; − meansthat only a very few progeny phages produce plaques;and + means that many progeny produce plaques(more than 10 times as many as in the − cases).1 2 3 4 5 6 7 8 91 − + + + + − − + +2 − + + + + − + +3 0 − + 0 + + −4 − + − + + +5 − + − + +6 0 0 − +7 0 + +8 − +9 −a. Which of the mutants are the three deletions? Whatcriteria did…
Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome 1. a discrete part of a protein that provides a unitof functionb. de novo gene 2. a nonfunctional member of a gene familyc. gene desert 3. the joining together of exons in a gene indifferent combinationsd. pseudogene 4. most frequent residues, either nucleotide oramino acid, found at each position in asequence alignmente. syntenic block 5. set of genes related by processes ofduplication and divergencef. orthologs 6. chromosomal region with the same genes inthe same order in two different speciesg. naturalselection7. genes with sequence similarities in twodifferent species that arose from a commonancestral geneh. consensussequence8. genes that arose by duplication within aspeciesi. gene family 9. genomic DNA sequences containing exonsj. paralogs 10. gene-poor region of the genomek. alternativeRNA splicing11. recently evolved from intergenic DNAsequencesl. protein domain 12. progressive…