22. You are studying variation in a human disease gene worldwide. You suspect that the disease iscaused by a missense mutation of the codon TCC to CCC in some individuals. You use a microarrayto assay the genotype of individuals at the polymorphic site, and find the following numbers of eachgenotype in in 3 different populationsPopulationTT countTC countCC countFrench4249Melanesian104050Yoruba43264What is the frequency of the T allele in each population?a. French: 0.09; Melanesian: 0.1; Yoruba: 0.04b. French: 0.3; Melanesian: 0.3; Yoruba: 0.2c. French: 0.3; Melanesian: 0.4; Yoruba: 0.3d. French: 0.7; Melanesian: 0.7; Yoruba: 0.8e. French: 0.1; Melanesian: 0.2; Yoruba: 0.3

The alleles are given in the three population French, Melanesian, Yoruba and the alleles are in TT,…

Answered: 22. You are studying variation in a…

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter16: Human Genetics And The Human Genome

Section: Chapter Questions

Problem 4TYU

See similar textbooks

Similar questions

What is a haplotype?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: On what basis did the authors conclude that evidence ofhorizontal transfer is absent from their data?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: What is meant by ”horizontal transfer”?
Price et al. [(1999). J. Bacteriol. 181:2358–2362] conducteda genetic study of the toxin transport protein (PA) of Bacillusanthracis, the bacterium that causes anthrax in humans. Withinthe 2294-nucleotide gene in 26 strains they identified five pointmutations—two missense and three synonyms—among differentisolates. Necropsy samples from an anthrax outbreak in 1979revealed a novel missense mutation and five unique nucleotidechanges among ten victims. The authors concluded that thesedata indicate little or no horizontal transfer between differentB. anthracis strains. Question: Which types of nucleotide changes (missense or synonyms)cause amino acid changes?
Shown below are eight DNA sequences from different individuals. Q.Give the haplotype of each sequence by listing the specific bases at each variable position in that particular haplotype.
che World Mona L A Leonardo da Vinci Museum - Flo x dSequenceViewer/14003927urlahttps%3A%2F%2F43160dd0-1a11-43d1-b28d-96e9e2abb6d2.sequences.api.brightspace.com2F1400392%2Factivity2217 1.07 Quiz: Experimentation UIZ: Experimentation Kate gathered three boxes of the same size made of different materials glass, clear plastic, and aluminum painted black She placed them on a window sill in the sun for an hour and then measured the warmth of the air in each box In this experiment, what is the warmth of the air? O an independent variable O a control O a constant O a dependent variable 2 3 45 Next
Shown below are eight DNA sequences from different individuals QGive the nucleotide positions of all single-nucleotide polymorphisms (SNPs; nucleotide positions where individuals vary in which base is present) in these sequences. uals
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
I sequence the DNA of 3 people and see variation in my gene of interest as follows: Person 1: ATGCAACAATTTAATAAT Person 2: ATGCAACGACGACGACGACAATTTAATAAT Person 3: ATGCAACGACGACGACGACGACGACGACGACAATTTAATAAT What is the name for this kind of variation?
The presence (+) or absence (−) of six sequences in each of five bacterial artificial chromosome (BAC) clones (A–E) is indicated in the following table. Using these markers, put the BAC clones in their correct order and indicate the locations of the numbered sequences within them.
Shown below are eight DNA sequences from different individuals QHow many different haplotypes (sets of linked variants) are found in these eight sequences
2. please answer this

SEE MORE QUESTIONS

Recommended textbooks for you

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology (MindTap Course List)

Biology

ISBN:

9781337392938

Author:

Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS